ID: 1007279221

View in Genome Browser
Species Human (GRCh38)
Location 6:40698172-40698194
Sequence GGTGGGGCATGTGACATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007279218_1007279221 -7 Left 1007279218 6:40698156-40698178 CCAGGGTCCGGGAGCAGGTGGGG No data
Right 1007279221 6:40698172-40698194 GGTGGGGCATGTGACATTATTGG No data
1007279214_1007279221 1 Left 1007279214 6:40698148-40698170 CCACGGTGCCAGGGTCCGGGAGC No data
Right 1007279221 6:40698172-40698194 GGTGGGGCATGTGACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007279221 Original CRISPR GGTGGGGCATGTGACATTAT TGG Intergenic
No off target data available for this crispr