ID: 1007283471

View in Genome Browser
Species Human (GRCh38)
Location 6:40730096-40730118
Sequence TTATTCACTCAACCGAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007283471_1007283477 24 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283477 6:40730143-40730165 AGGATAAAATGAGATGATGCAGG No data
1007283471_1007283478 25 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG No data
1007283471_1007283474 -5 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283474 6:40730114-40730136 AATAATGGTATCTGCTACCAGGG No data
1007283471_1007283473 -6 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283473 6:40730113-40730135 GAATAATGGTATCTGCTACCAGG No data
1007283471_1007283475 4 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283475 6:40730123-40730145 ATCTGCTACCAGGGTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007283471 Original CRISPR TTATTCACTCAACCGAAATC AGG (reversed) Intergenic
No off target data available for this crispr