ID: 1007283476

View in Genome Browser
Species Human (GRCh38)
Location 6:40730131-40730153
Sequence CATTTTATCCTCAAGAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007283476_1007283481 13 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283481 6:40730167-40730189 AAAGCATTTGGTTAGCCAATGGG No data
1007283476_1007283482 19 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283482 6:40730173-40730195 TTTGGTTAGCCAATGGGAACTGG No data
1007283476_1007283480 12 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283480 6:40730166-40730188 GAAAGCATTTGGTTAGCCAATGG No data
1007283476_1007283478 -10 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG No data
1007283476_1007283479 1 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283479 6:40730155-40730177 GATGATGCAGGGAAAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007283476 Original CRISPR CATTTTATCCTCAAGAACCC TGG (reversed) Intergenic
No off target data available for this crispr