ID: 1007283478

View in Genome Browser
Species Human (GRCh38)
Location 6:40730144-40730166
Sequence GGATAAAATGAGATGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007283471_1007283478 25 Left 1007283471 6:40730096-40730118 CCTGATTTCGGTTGAGTGAATAA No data
Right 1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG No data
1007283476_1007283478 -10 Left 1007283476 6:40730131-40730153 CCAGGGTTCTTGAGGATAAAATG No data
Right 1007283478 6:40730144-40730166 GGATAAAATGAGATGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007283478 Original CRISPR GGATAAAATGAGATGATGCA GGG Intergenic
No off target data available for this crispr