ID: 1007285001

View in Genome Browser
Species Human (GRCh38)
Location 6:40741258-40741280
Sequence CAGAGTTCAGAGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007285001_1007285009 29 Left 1007285001 6:40741258-40741280 CCTCCAGCCTTCTCTGAACTCTG No data
Right 1007285009 6:40741310-40741332 TCAGGCAAGCAGAAATTTCTGGG No data
1007285001_1007285006 11 Left 1007285001 6:40741258-40741280 CCTCCAGCCTTCTCTGAACTCTG No data
Right 1007285006 6:40741292-40741314 AACTAGAATTACCTCACTTCAGG No data
1007285001_1007285008 28 Left 1007285001 6:40741258-40741280 CCTCCAGCCTTCTCTGAACTCTG No data
Right 1007285008 6:40741309-40741331 TTCAGGCAAGCAGAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007285001 Original CRISPR CAGAGTTCAGAGAAGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr