ID: 1007287190

View in Genome Browser
Species Human (GRCh38)
Location 6:40756054-40756076
Sequence CAGATCATGGGGTTGTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007287190_1007287196 12 Left 1007287190 6:40756054-40756076 CCTTATAACAACCCCATGATCTG No data
Right 1007287196 6:40756089-40756111 ACCATCCCATCTCCTAGATGAGG No data
1007287190_1007287201 27 Left 1007287190 6:40756054-40756076 CCTTATAACAACCCCATGATCTG No data
Right 1007287201 6:40756104-40756126 AGATGAGGAAACAAGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007287190 Original CRISPR CAGATCATGGGGTTGTTATA AGG (reversed) Intergenic
No off target data available for this crispr