ID: 1007290089

View in Genome Browser
Species Human (GRCh38)
Location 6:40779080-40779102
Sequence GAAACTCTTGTGGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007290089_1007290095 13 Left 1007290089 6:40779080-40779102 CCTGCTCTGGCCACAAGAGTTTC No data
Right 1007290095 6:40779116-40779138 CACCGCTGTTATCTTGCTGGTGG No data
1007290089_1007290094 10 Left 1007290089 6:40779080-40779102 CCTGCTCTGGCCACAAGAGTTTC No data
Right 1007290094 6:40779113-40779135 CCACACCGCTGTTATCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007290089 Original CRISPR GAAACTCTTGTGGCCAGAGC AGG (reversed) Intergenic
No off target data available for this crispr