ID: 1007291519

View in Genome Browser
Species Human (GRCh38)
Location 6:40790890-40790912
Sequence CTGCTGTTGTGGAGGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007291519_1007291526 -1 Left 1007291519 6:40790890-40790912 CCATTTACCCTCCACAACAGCAG No data
Right 1007291526 6:40790912-40790934 GTGAGGGAGGTACTGTTATGAGG No data
1007291519_1007291527 2 Left 1007291519 6:40790890-40790912 CCATTTACCCTCCACAACAGCAG No data
Right 1007291527 6:40790915-40790937 AGGGAGGTACTGTTATGAGGAGG No data
1007291519_1007291530 26 Left 1007291519 6:40790890-40790912 CCATTTACCCTCCACAACAGCAG No data
Right 1007291530 6:40790939-40790961 CCTTTTGCTAATACAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007291519 Original CRISPR CTGCTGTTGTGGAGGGTAAA TGG (reversed) Intergenic
No off target data available for this crispr