ID: 1007296562

View in Genome Browser
Species Human (GRCh38)
Location 6:40826740-40826762
Sequence GTTCAGCCAATGCAAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007296562_1007296564 11 Left 1007296562 6:40826740-40826762 CCCTTCTTTTGCATTGGCTGAAC No data
Right 1007296564 6:40826774-40826796 GAATTCTATAAACTCCTTCAAGG No data
1007296562_1007296565 21 Left 1007296562 6:40826740-40826762 CCCTTCTTTTGCATTGGCTGAAC No data
Right 1007296565 6:40826784-40826806 AACTCCTTCAAGGACACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007296562 Original CRISPR GTTCAGCCAATGCAAAAGAA GGG (reversed) Intergenic
No off target data available for this crispr