ID: 1007297672

View in Genome Browser
Species Human (GRCh38)
Location 6:40838865-40838887
Sequence GTTACATTTGAACAAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007297672_1007297677 3 Left 1007297672 6:40838865-40838887 CCAGTGACTTGTTCAAATGTAAC No data
Right 1007297677 6:40838891-40838913 GGGAGTGAATCAGCTTTTAGTGG No data
1007297672_1007297678 20 Left 1007297672 6:40838865-40838887 CCAGTGACTTGTTCAAATGTAAC No data
Right 1007297678 6:40838908-40838930 TAGTGGAATAAAGATTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007297672 Original CRISPR GTTACATTTGAACAAGTCAC TGG (reversed) Intergenic
No off target data available for this crispr