ID: 1007304043

View in Genome Browser
Species Human (GRCh38)
Location 6:40890646-40890668
Sequence GCAAAGGCAGGATTGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007304043_1007304047 -6 Left 1007304043 6:40890646-40890668 CCAGCTTCCAATCCTGCCTTTGC No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304043_1007304050 18 Left 1007304043 6:40890646-40890668 CCAGCTTCCAATCCTGCCTTTGC No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007304043 Original CRISPR GCAAAGGCAGGATTGGAAGC TGG (reversed) Intergenic