ID: 1007304044

View in Genome Browser
Species Human (GRCh38)
Location 6:40890653-40890675
Sequence GAGAGCAGCAAAGGCAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007304044_1007304050 11 Left 1007304044 6:40890653-40890675 CCAATCCTGCCTTTGCTGCTCTC No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007304044 Original CRISPR GAGAGCAGCAAAGGCAGGAT TGG (reversed) Intergenic
No off target data available for this crispr