ID: 1007304045

View in Genome Browser
Species Human (GRCh38)
Location 6:40890658-40890680
Sequence CAGCTGAGAGCAGCAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007304045_1007304050 6 Left 1007304045 6:40890658-40890680 CCTGCCTTTGCTGCTCTCAGCTG No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007304045 Original CRISPR CAGCTGAGAGCAGCAAAGGC AGG (reversed) Intergenic