ID: 1007304047

View in Genome Browser
Species Human (GRCh38)
Location 6:40890663-40890685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007304039_1007304047 25 Left 1007304039 6:40890615-40890637 CCGCTACATGTCAGGGTCCCAGA No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304042_1007304047 2 Left 1007304042 6:40890638-40890660 CCTGTTAGCCAGCTTCCAATCCT No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304041_1007304047 7 Left 1007304041 6:40890633-40890655 CCAGACCTGTTAGCCAGCTTCCA No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304038_1007304047 26 Left 1007304038 6:40890614-40890636 CCCGCTACATGTCAGGGTCCCAG No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304037_1007304047 27 Left 1007304037 6:40890613-40890635 CCCCGCTACATGTCAGGGTCCCA No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304040_1007304047 8 Left 1007304040 6:40890632-40890654 CCCAGACCTGTTAGCCAGCTTCC No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304036_1007304047 30 Left 1007304036 6:40890610-40890632 CCTCCCCGCTACATGTCAGGGTC No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data
1007304043_1007304047 -6 Left 1007304043 6:40890646-40890668 CCAGCTTCCAATCCTGCCTTTGC No data
Right 1007304047 6:40890663-40890685 CTTTGCTGCTCTCAGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007304047 Original CRISPR CTTTGCTGCTCTCAGCTGTG AGG Intergenic