ID: 1007304050

View in Genome Browser
Species Human (GRCh38)
Location 6:40890687-40890709
Sequence CCTGAAGCCCCTCCCTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007304045_1007304050 6 Left 1007304045 6:40890658-40890680 CCTGCCTTTGCTGCTCTCAGCTG No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data
1007304042_1007304050 26 Left 1007304042 6:40890638-40890660 CCTGTTAGCCAGCTTCCAATCCT No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data
1007304043_1007304050 18 Left 1007304043 6:40890646-40890668 CCAGCTTCCAATCCTGCCTTTGC No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data
1007304046_1007304050 2 Left 1007304046 6:40890662-40890684 CCTTTGCTGCTCTCAGCTGTGAG No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data
1007304044_1007304050 11 Left 1007304044 6:40890653-40890675 CCAATCCTGCCTTTGCTGCTCTC No data
Right 1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007304050 Original CRISPR CCTGAAGCCCCTCCCTGCTC TGG Intergenic
No off target data available for this crispr