ID: 1007308863

View in Genome Browser
Species Human (GRCh38)
Location 6:40929102-40929124
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007308863_1007308865 -10 Left 1007308863 6:40929102-40929124 CCACCAGATTTTTCTAGTGCACA No data
Right 1007308865 6:40929115-40929137 CTAGTGCACATTAAAGTTTGAGG No data
1007308863_1007308866 10 Left 1007308863 6:40929102-40929124 CCACCAGATTTTTCTAGTGCACA No data
Right 1007308866 6:40929135-40929157 AGGACCATTGATCACGCGTCTGG No data
1007308863_1007308868 23 Left 1007308863 6:40929102-40929124 CCACCAGATTTTTCTAGTGCACA No data
Right 1007308868 6:40929148-40929170 ACGCGTCTGGCCACATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007308863 Original CRISPR TGTGCACTAGAAAAATCTGG TGG (reversed) Intergenic
No off target data available for this crispr