ID: 1007311977

View in Genome Browser
Species Human (GRCh38)
Location 6:40954012-40954034
Sequence TTGATCAGAAGTACATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007311973_1007311977 12 Left 1007311973 6:40953977-40953999 CCAAATCTGTCATCCCACACAGT No data
Right 1007311977 6:40954012-40954034 TTGATCAGAAGTACATGAGCTGG No data
1007311975_1007311977 -2 Left 1007311975 6:40953991-40954013 CCACACAGTAGCATGTCCACTTT No data
Right 1007311977 6:40954012-40954034 TTGATCAGAAGTACATGAGCTGG No data
1007311974_1007311977 -1 Left 1007311974 6:40953990-40954012 CCCACACAGTAGCATGTCCACTT No data
Right 1007311977 6:40954012-40954034 TTGATCAGAAGTACATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007311977 Original CRISPR TTGATCAGAAGTACATGAGC TGG Intergenic
No off target data available for this crispr