ID: 1007318831

View in Genome Browser
Species Human (GRCh38)
Location 6:41011599-41011621
Sequence GGACCCTCAGGGAGGCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007318831_1007318836 15 Left 1007318831 6:41011599-41011621 CCACAAGGCCTCCCTGAGGGTCC No data
Right 1007318836 6:41011637-41011659 TATCAGCACATGTGTCCAGCAGG No data
1007318831_1007318838 26 Left 1007318831 6:41011599-41011621 CCACAAGGCCTCCCTGAGGGTCC No data
Right 1007318838 6:41011648-41011670 GTGTCCAGCAGGGCCTTTGATGG No data
1007318831_1007318837 16 Left 1007318831 6:41011599-41011621 CCACAAGGCCTCCCTGAGGGTCC No data
Right 1007318837 6:41011638-41011660 ATCAGCACATGTGTCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007318831 Original CRISPR GGACCCTCAGGGAGGCCTTG TGG (reversed) Intergenic
No off target data available for this crispr