ID: 1007318982

View in Genome Browser
Species Human (GRCh38)
Location 6:41012662-41012684
Sequence CTGAGGGGCTTGATATGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007318982_1007318988 -5 Left 1007318982 6:41012662-41012684 CCAAACCATATCAAGCCCCTCAG No data
Right 1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG No data
1007318982_1007318990 24 Left 1007318982 6:41012662-41012684 CCAAACCATATCAAGCCCCTCAG No data
Right 1007318990 6:41012709-41012731 CTCATGAAGTGTAATCTAAAAGG No data
1007318982_1007318985 -8 Left 1007318982 6:41012662-41012684 CCAAACCATATCAAGCCCCTCAG No data
Right 1007318985 6:41012677-41012699 CCCCTCAGCCAACATTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007318982 Original CRISPR CTGAGGGGCTTGATATGGTT TGG (reversed) Intergenic
No off target data available for this crispr