ID: 1007318983

View in Genome Browser
Species Human (GRCh38)
Location 6:41012667-41012689
Sequence GTTGGCTGAGGGGCTTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007318983_1007318990 19 Left 1007318983 6:41012667-41012689 CCATATCAAGCCCCTCAGCCAAC No data
Right 1007318990 6:41012709-41012731 CTCATGAAGTGTAATCTAAAAGG No data
1007318983_1007318988 -10 Left 1007318983 6:41012667-41012689 CCATATCAAGCCCCTCAGCCAAC No data
Right 1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007318983 Original CRISPR GTTGGCTGAGGGGCTTGATA TGG (reversed) Intergenic
No off target data available for this crispr