ID: 1007318988

View in Genome Browser
Species Human (GRCh38)
Location 6:41012680-41012702
Sequence CTCAGCCAACATTTTCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007318983_1007318988 -10 Left 1007318983 6:41012667-41012689 CCATATCAAGCCCCTCAGCCAAC No data
Right 1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG No data
1007318982_1007318988 -5 Left 1007318982 6:41012662-41012684 CCAAACCATATCAAGCCCCTCAG No data
Right 1007318988 6:41012680-41012702 CTCAGCCAACATTTTCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007318988 Original CRISPR CTCAGCCAACATTTTCATGG TGG Intergenic
No off target data available for this crispr