ID: 1007319616

View in Genome Browser
Species Human (GRCh38)
Location 6:41018012-41018034
Sequence CATTCCACACAGAAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007319605_1007319616 20 Left 1007319605 6:41017969-41017991 CCAACCCAATTCCACTGGACTCC No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319610_1007319616 -1 Left 1007319610 6:41017990-41018012 CCCCTGGCCTGAAGCTTCTCTGC No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319603_1007319616 22 Left 1007319603 6:41017967-41017989 CCCCAACCCAATTCCACTGGACT No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319607_1007319616 15 Left 1007319607 6:41017974-41017996 CCAATTCCACTGGACTCCCCTGG No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319612_1007319616 -3 Left 1007319612 6:41017992-41018014 CCTGGCCTGAAGCTTCTCTGCAT No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319609_1007319616 9 Left 1007319609 6:41017980-41018002 CCACTGGACTCCCCTGGCCTGAA No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319604_1007319616 21 Left 1007319604 6:41017968-41017990 CCCAACCCAATTCCACTGGACTC No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319611_1007319616 -2 Left 1007319611 6:41017991-41018013 CCCTGGCCTGAAGCTTCTCTGCA No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319613_1007319616 -8 Left 1007319613 6:41017997-41018019 CCTGAAGCTTCTCTGCATTCCAC No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data
1007319606_1007319616 16 Left 1007319606 6:41017973-41017995 CCCAATTCCACTGGACTCCCCTG No data
Right 1007319616 6:41018012-41018034 CATTCCACACAGAAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007319616 Original CRISPR CATTCCACACAGAAAGTGGG TGG Intergenic
No off target data available for this crispr