ID: 1007320010

View in Genome Browser
Species Human (GRCh38)
Location 6:41021347-41021369
Sequence CCTTGGTGCAGTCAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007320010_1007320018 2 Left 1007320010 6:41021347-41021369 CCAGCCCCCTGACTGCACCAAGG No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320010 Original CRISPR CCTTGGTGCAGTCAGGGGGC TGG (reversed) Intergenic