ID: 1007320013

View in Genome Browser
Species Human (GRCh38)
Location 6:41021351-41021373
Sequence TCACCCTTGGTGCAGTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007320013_1007320018 -2 Left 1007320013 6:41021351-41021373 CCCCCTGACTGCACCAAGGGTGA No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320013_1007320024 30 Left 1007320013 6:41021351-41021373 CCCCCTGACTGCACCAAGGGTGA No data
Right 1007320024 6:41021404-41021426 CCTCTGAGACAAATCCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320013 Original CRISPR TCACCCTTGGTGCAGTCAGG GGG (reversed) Intergenic