ID: 1007320016

View in Genome Browser
Species Human (GRCh38)
Location 6:41021354-41021376
Sequence CTCTCACCCTTGGTGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007320016_1007320018 -5 Left 1007320016 6:41021354-41021376 CCTGACTGCACCAAGGGTGAGAG No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320016_1007320025 28 Left 1007320016 6:41021354-41021376 CCTGACTGCACCAAGGGTGAGAG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320016_1007320024 27 Left 1007320016 6:41021354-41021376 CCTGACTGCACCAAGGGTGAGAG No data
Right 1007320024 6:41021404-41021426 CCTCTGAGACAAATCCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320016 Original CRISPR CTCTCACCCTTGGTGCAGTC AGG (reversed) Intergenic