ID: 1007320018

View in Genome Browser
Species Human (GRCh38)
Location 6:41021372-41021394
Sequence GAGAGAAAGCATCTGCCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007320015_1007320018 -4 Left 1007320015 6:41021353-41021375 CCCTGACTGCACCAAGGGTGAGA No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320014_1007320018 -3 Left 1007320014 6:41021352-41021374 CCCCTGACTGCACCAAGGGTGAG No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320013_1007320018 -2 Left 1007320013 6:41021351-41021373 CCCCCTGACTGCACCAAGGGTGA No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320016_1007320018 -5 Left 1007320016 6:41021354-41021376 CCTGACTGCACCAAGGGTGAGAG No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data
1007320010_1007320018 2 Left 1007320010 6:41021347-41021369 CCAGCCCCCTGACTGCACCAAGG No data
Right 1007320018 6:41021372-41021394 GAGAGAAAGCATCTGCCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320018 Original CRISPR GAGAGAAAGCATCTGCCCCT TGG Intergenic