ID: 1007320019 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:41021387-41021409 |
| Sequence | CAGAGGGAAATAATACCAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007320019_1007320028 | 23 | Left | 1007320019 | 6:41021387-41021409 | CCCCTTGGTATTATTTCCCTCTG | No data | ||
| Right | 1007320028 | 6:41021433-41021455 | TGATTCTTGAAAGCAAGTCATGG | No data | ||||
| 1007320019_1007320024 | -6 | Left | 1007320019 | 6:41021387-41021409 | CCCCTTGGTATTATTTCCCTCTG | No data | ||
| Right | 1007320024 | 6:41021404-41021426 | CCTCTGAGACAAATCCCACTAGG | No data | ||||
| 1007320019_1007320025 | -5 | Left | 1007320019 | 6:41021387-41021409 | CCCCTTGGTATTATTTCCCTCTG | No data | ||
| Right | 1007320025 | 6:41021405-41021427 | CTCTGAGACAAATCCCACTAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007320019 | Original CRISPR | CAGAGGGAAATAATACCAAG GGG (reversed) | Intergenic | ||