ID: 1007320025

View in Genome Browser
Species Human (GRCh38)
Location 6:41021405-41021427
Sequence CTCTGAGACAAATCCCACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007320019_1007320025 -5 Left 1007320019 6:41021387-41021409 CCCCTTGGTATTATTTCCCTCTG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320020_1007320025 -6 Left 1007320020 6:41021388-41021410 CCCTTGGTATTATTTCCCTCTGA No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320021_1007320025 -7 Left 1007320021 6:41021389-41021411 CCTTGGTATTATTTCCCTCTGAG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320015_1007320025 29 Left 1007320015 6:41021353-41021375 CCCTGACTGCACCAAGGGTGAGA No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320014_1007320025 30 Left 1007320014 6:41021352-41021374 CCCCTGACTGCACCAAGGGTGAG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320016_1007320025 28 Left 1007320016 6:41021354-41021376 CCTGACTGCACCAAGGGTGAGAG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data
1007320017_1007320025 18 Left 1007320017 6:41021364-41021386 CCAAGGGTGAGAGAAAGCATCTG No data
Right 1007320025 6:41021405-41021427 CTCTGAGACAAATCCCACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320025 Original CRISPR CTCTGAGACAAATCCCACTA GGG Intergenic