ID: 1007320734

View in Genome Browser
Species Human (GRCh38)
Location 6:41027390-41027412
Sequence CTGAAACACAGGTGCAGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 265}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007320734 Original CRISPR CTGAAACACAGGTGCAGAGC GGG Exonic
900630060 1:3630169-3630191 CAGGCCCACAGGTGCAGAGCCGG - Intergenic
900920548 1:5667675-5667697 CTGAACCACTGGTGCAGGGGAGG - Intergenic
902403426 1:16170600-16170622 CTGAGACTCAGGGGCAGAGTTGG + Intergenic
903287983 1:22288879-22288901 CAGAAACTCAGGTTCAGAGTCGG + Intergenic
904038352 1:27570673-27570695 CTGTGACACAGGTACAGACCTGG - Intronic
904412266 1:30331604-30331626 CAGAGTCACAGGTTCAGAGCTGG + Intergenic
905783471 1:40733253-40733275 CAGAAAGAGAGGTGCAGATCGGG + Intronic
906322995 1:44828167-44828189 CTGAATCACCTGAGCAGAGCAGG + Exonic
907184900 1:52602241-52602263 GTGAAACTGAGGTCCAGAGCCGG + Intergenic
907494350 1:54833311-54833333 CTGAAGCACAGGGTCAGAGTCGG - Intronic
908205914 1:61849220-61849242 CTGTAATACAGCTGTAGAGCAGG + Intronic
911156561 1:94642960-94642982 CTGAAACATAGGTGATGAGAAGG - Intergenic
911924852 1:103817148-103817170 CTGAGGGACAGGAGCAGAGCTGG + Intergenic
913201196 1:116496357-116496379 CTGAAACACAAGAGCACAGGAGG + Intergenic
917256602 1:173122983-173123005 TGGAGACACAGCTGCAGAGCAGG - Intergenic
920925020 1:210332981-210333003 CTGAGACAAATGTGCAGTGCAGG + Intronic
920947847 1:210546453-210546475 CTGGCACAGAGGTGCAGAGGTGG + Intronic
923083736 1:230685378-230685400 ATGAAACACAGACACAGAGCTGG - Intronic
924383201 1:243482129-243482151 CTGAAGCATAGGACCAGAGCTGG + Intronic
1064139574 10:12778979-12779001 GAGAGTCACAGGTGCAGAGCAGG + Intronic
1065749145 10:28869598-28869620 CTAACACAAAGGTGGAGAGCTGG + Intronic
1066203044 10:33160260-33160282 CTGACAGACAGGTGTAGTGCTGG - Intergenic
1066543821 10:36477602-36477624 CTGAATCACATGGGCAGGGCAGG + Intergenic
1068024957 10:51631297-51631319 CTGAGACAAATGTGCAGTGCAGG + Intronic
1070289098 10:75103346-75103368 CACAGACACAGGTGTAGAGCAGG + Intronic
1070734716 10:78855564-78855586 CAGGAACACATGTGCAGGGCGGG + Intergenic
1071056704 10:81519988-81520010 CTGAGGCACAGGTGCAGAGCAGG + Intergenic
1071303096 10:84272525-84272547 CTGAAAAACAGGTGAACAGATGG - Intergenic
1075482089 10:122790326-122790348 CTGAGGCAGAGGTGCATAGCTGG + Intergenic
1075783773 10:125034178-125034200 CTGATTCACAGCTGCAGAACGGG + Intronic
1076016329 10:127030251-127030273 CAGAAACAGAGGACCAGAGCTGG - Intronic
1077458721 11:2698002-2698024 CTGGAAAACAGGTGCAGAAATGG + Intronic
1077546076 11:3170610-3170632 CTTAAACCCAGGTTCTGAGCTGG - Intergenic
1077698278 11:4415013-4415035 CTGAAGGACAGGTGCAGAAGAGG + Intergenic
1078931129 11:15912818-15912840 CTGTAGCCCAGGTGAAGAGCAGG + Intergenic
1079311817 11:19373283-19373305 CTGGAGCACAGGTGAATAGCTGG - Intronic
1083901023 11:65643577-65643599 CTGAAACACAGGAGCAGTACTGG + Intronic
1087215086 11:95485007-95485029 CTGGAGCACAGGTTCATAGCTGG - Intergenic
1088030076 11:105237848-105237870 CTGAGATACACGTGCAGAACGGG + Intergenic
1090252069 11:125258672-125258694 CTGAAAAACAGGGCCAGAGAGGG + Intronic
1092881136 12:12888617-12888639 CAGGGACACAGGTGCAGGGCCGG + Intergenic
1093766355 12:22967839-22967861 CTGCACAACAGGTGCAGTGCAGG + Intergenic
1097395407 12:59067306-59067328 CTGAAACACAGACTCAAAGCTGG - Intergenic
1098242723 12:68485015-68485037 CTGGAGCACAGGTGATGAGCCGG + Intergenic
1100018774 12:90044958-90044980 CTGGAATACATGTGCAGAACAGG + Intergenic
1101204361 12:102470657-102470679 CTGTCACACAGATGCATAGCAGG + Intronic
1101758853 12:107642989-107643011 TAGAAATACAGGTGCAAAGCCGG - Intronic
1101938457 12:109080111-109080133 CTGAACCACACGTGCACAGGGGG - Intronic
1102460775 12:113098284-113098306 AAGGAACTCAGGTGCAGAGCTGG + Intergenic
1104803507 12:131570532-131570554 CTGAGAAACAGATGCAGTGCAGG + Intergenic
1104901383 12:132191136-132191158 CTGTAACACAGGACCACAGCAGG - Intergenic
1108497377 13:51039026-51039048 CTGAAATACAGCTGCAGCCCAGG + Intergenic
1110209258 13:72953250-72953272 CAGAGGCACAGGTGCAGTGCTGG - Intronic
1110471172 13:75861822-75861844 CTGCCTCAGAGGTGCAGAGCTGG + Intergenic
1110804661 13:79739960-79739982 CTGATACAAAGTTGCAGAGGAGG - Intergenic
1111758788 13:92434786-92434808 ATCAAAGACAGGAGCAGAGCTGG + Intronic
1112394211 13:99013728-99013750 CAGACACACAGGTGAAGAGAAGG + Intronic
1114427005 14:22632190-22632212 CTGAACCACAGGCCCAGAGTGGG + Intergenic
1114697938 14:24644842-24644864 CAGAGAGACAGGTGCAGTGCTGG + Intergenic
1115112790 14:29843861-29843883 CTTAAACACAGCTGCAGGACAGG + Intronic
1117242401 14:53847960-53847982 ATGAAACAAAGGTGTGGAGCTGG - Intergenic
1117248538 14:53911905-53911927 CTGAAAGACAGGGGCAAAGTGGG + Intergenic
1118560811 14:67080037-67080059 CTGAAACCCTTGTGCACAGCTGG - Intronic
1119750685 14:77075365-77075387 CTGAAATGGAGGTGCAGAACAGG + Intergenic
1120140774 14:80927260-80927282 CAGAGGCACAGGTGCAGTGCTGG + Intronic
1120175613 14:81290069-81290091 CAGTAACACTGCTGCAGAGCTGG + Intronic
1120635914 14:86950703-86950725 CTGAAACACAGGTCTTGAGCAGG - Intergenic
1121234803 14:92384461-92384483 CTCAAGCACAGGCCCAGAGCAGG - Intronic
1121333831 14:93064594-93064616 CTGGGACACAGCTGCAGGGCCGG + Intronic
1121401836 14:93686549-93686571 CTGAAACACAAGGACACAGCTGG - Intronic
1122364739 14:101187929-101187951 CTGCAAGTCAGGTGCAAAGCAGG + Intergenic
1122809978 14:104283070-104283092 GTTAAACACAGGAGCAGGGCTGG + Intergenic
1122829036 14:104386735-104386757 CTGACAGACAGATGTAGAGCCGG + Intergenic
1124545216 15:30620537-30620559 CTGAAAAACAGGTACTGAGATGG + Intergenic
1124681165 15:31732271-31732293 CTGGTACACATGCGCAGAGCTGG + Intronic
1124778741 15:32609929-32609951 CTGAAAAACAGGTACTGAGATGG + Intergenic
1125464638 15:39938691-39938713 CAGATACACAGGGACAGAGCTGG - Intronic
1125921326 15:43527497-43527519 CCGAAACACATCTGCAGAGAAGG + Exonic
1126257438 15:46644206-46644228 CTGAAACAGAGCTGCAGAGCAGG - Intergenic
1127695324 15:61441234-61441256 CCAAACCACAGGAGCAGAGCAGG - Intergenic
1127752661 15:62060821-62060843 CTGATCCACAGGTGCAGGGGTGG - Intergenic
1129653063 15:77505168-77505190 CTGGAGCACAGGTCCAGGGCTGG - Intergenic
1130602260 15:85284174-85284196 CTGAAACACAGCTGCTGTGGAGG + Intergenic
1130766746 15:86878820-86878842 CTGAAACACAGCTGCTGTGGAGG - Intronic
1131413764 15:92233301-92233323 CTGAGGCACAGTTGCAGTGCTGG + Intergenic
1131766979 15:95688048-95688070 GTGAAAGACAGGTGCATAGATGG - Intergenic
1132631127 16:917990-918012 AAGACATACAGGTGCAGAGCTGG + Intronic
1134183042 16:12062821-12062843 CTGAAGCACAGAGGCAGGGCGGG + Intronic
1139170490 16:64625502-64625524 CAGAGGCACAGGTGCAGTGCTGG - Intergenic
1139380929 16:66530349-66530371 TTGAAACATAGGTGCTGATCAGG + Intronic
1145970837 17:28955625-28955647 CTGGAACACACTAGCAGAGCAGG - Exonic
1146061379 17:29609197-29609219 CTGAGGAACAGGTGCTGAGCCGG + Exonic
1147512551 17:41083960-41083982 TAGAAACACAGGAGCACAGCAGG + Intergenic
1147513957 17:41098311-41098333 TGGAAACACAGGAGCACAGCAGG - Intronic
1147514718 17:41105142-41105164 TAGAAACACAGGAGCACAGCAGG + Intronic
1147516062 17:41118540-41118562 TGGAAACACAGGAGCACAGCAGG - Intergenic
1148404653 17:47400231-47400253 CTGAAACAAAGATTCAGATCTGG - Intronic
1149974694 17:61253713-61253735 GTGGAACAGAGGTGCAGAGGTGG + Intronic
1150641301 17:66951622-66951644 CTGAAATCCAGGTGCAGATAGGG + Intergenic
1150655223 17:67034758-67034780 CTGAGGCTCAGGTGCAGAGATGG - Intergenic
1155172241 18:23275518-23275540 CTGAACTACAGAGGCAGAGCAGG + Intronic
1155386155 18:25280057-25280079 CAGAATCACAGGCTCAGAGCTGG + Intronic
1155420828 18:25654226-25654248 CCGAAAAACTGGGGCAGAGCAGG - Intergenic
1158381835 18:56940302-56940324 CTGAAATACATTTGCATAGCAGG - Intronic
1158680444 18:59561799-59561821 CTCACACACAGCTGCACAGCCGG - Intronic
1161781687 19:6297388-6297410 CCAAACCACAGCTGCAGAGCCGG + Intergenic
1161883479 19:6974509-6974531 CAGGAACACAGGTTCAGAGAGGG + Intergenic
1162231504 19:9270725-9270747 CTGACCCACAGCTGCAGACCTGG + Intergenic
1163688272 19:18724664-18724686 ATGAGACACAGATGCAGAGGGGG - Intronic
1164636282 19:29793679-29793701 CATGAACACAGGCGCAGAGCAGG - Intergenic
1166571057 19:43797668-43797690 CTGAAGCACTGGTGAAGGGCTGG + Exonic
1167104301 19:47421228-47421250 CTGTAAAACAGGTGCAGGACAGG - Intergenic
1168118136 19:54236937-54236959 CAGAAATACAGGTGGAGAGAAGG + Intronic
924980168 2:212244-212266 CTGAAAGTCAGGGGAAGAGCTGG - Intergenic
925490793 2:4390661-4390683 CAGAGCCACAGGGGCAGAGCTGG - Intergenic
926224180 2:10955566-10955588 CTGGAGCCCAGGTGCAGGGCAGG - Intergenic
926554449 2:14341327-14341349 CTGAGCCACAGCTGCAGACCTGG + Intergenic
926685546 2:15695157-15695179 CTGAAACACATCTGAAGGGCCGG - Intronic
927915028 2:26930106-26930128 CTGAAACACAGGCACTGATCAGG - Intronic
928252807 2:29696746-29696768 CAGACACGCAGGTGCAGATCAGG - Intronic
928986650 2:37188809-37188831 CTAAACCACAGGTGCAAAACAGG + Intronic
932448734 2:71796268-71796290 CAGAAACACAGGCCCAGAGGTGG - Intergenic
935949722 2:108317543-108317565 CAGAGACACAGCTGCAGTGCTGG + Intergenic
936883835 2:117284653-117284675 CTGAAACAAAGGTGAAGACATGG + Intergenic
937308880 2:120889149-120889171 CTGAGACACAGGGGCAGAAAAGG - Intronic
938758226 2:134400142-134400164 CAGAACCACAGGTGCAAAACTGG + Intronic
939230890 2:139424881-139424903 CTGGGACACATGTGCAGAACGGG - Intergenic
941569458 2:167152079-167152101 CTGAAACACAAGTACACAGTTGG - Intronic
943728654 2:191278674-191278696 ATAAAACACTGCTGCAGAGCAGG + Intronic
944370292 2:198974371-198974393 CAGAAGCACAGGTGCAGTGCTGG + Intergenic
944919818 2:204401091-204401113 CTGAAACTCATGTGCATACCAGG - Intergenic
945521572 2:210833851-210833873 CAGAGGCACAGGTGCAGTGCTGG - Intergenic
946232828 2:218303241-218303263 CTGAAAGACTGGTTCAGGGCTGG - Intronic
946432482 2:219632999-219633021 CTGAAGCACAGGTGCCGGGGTGG + Exonic
948288499 2:236806376-236806398 CTGAAGAACAGGGGCACAGCGGG + Intergenic
949039767 2:241842802-241842824 CTGAACCACAGTTGCTGGGCGGG - Intergenic
1169575164 20:6951501-6951523 CAGCAACACAGCTGCACAGCAGG - Intergenic
1170060711 20:12255983-12256005 CTGATATCAAGGTGCAGAGCTGG + Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1170813467 20:19693645-19693667 CTGAAGCAGAGCTGCATAGCAGG - Intronic
1172096822 20:32464440-32464462 GTGAACCACAGGGACAGAGCTGG - Intronic
1172327520 20:34048044-34048066 CAGAGATACAGGAGCAGAGCAGG + Intronic
1175548984 20:59803936-59803958 CTGAGAAACAGGTGCAGGGACGG - Intronic
1175630813 20:60534959-60534981 ATGAAACAAATGTGCAGAGAAGG + Intergenic
1175695577 20:61100659-61100681 GTGATTCACAGGTGCAGAGCAGG + Intergenic
1175748225 20:61476573-61476595 GTGAGACACAGGTGGAGAGTGGG + Intronic
1176244737 20:64092033-64092055 GTCGAGCACAGGTGCAGAGCAGG - Exonic
1177421762 21:20868469-20868491 TTGAAACAGAGCTGCATAGCTGG + Intergenic
1178668123 21:34566556-34566578 CTGAAAAAAAGGGGCAGAGGAGG + Intronic
1179043751 21:37827897-37827919 ATGAAACCCAGGTGGGGAGCTGG + Intronic
1179287979 21:39994591-39994613 CTGAAACAGTGGCACAGAGCCGG - Intergenic
1179682441 21:43033105-43033127 CTGCTCCACAGGTGCAGGGCAGG - Exonic
1181802009 22:25353952-25353974 CTGACACACAGGTGCAGCGCAGG + Intronic
1182530618 22:30953321-30953343 ATGAAGCACAGCTGCAAAGCAGG - Intronic
1182718269 22:32377174-32377196 CTGACACACAGGTGGGGAGGCGG + Intronic
1183225903 22:36549658-36549680 CAGCCACACAGGGGCAGAGCTGG - Intergenic
1183366132 22:37407985-37408007 ATGAAACAGAGGTCCAGAGAAGG - Intronic
1184149510 22:42630161-42630183 CTGAAACACACATGCCGAGTGGG - Intronic
1184321196 22:43743437-43743459 CTGAATAACAGGTGCGGAGCTGG - Intronic
1184751326 22:46488108-46488130 CTGAAACTGAGGTGCAGGGCAGG - Intronic
1184848199 22:47102033-47102055 CTGAAACAAAGGTCTTGAGCTGG - Intronic
1184956209 22:47888207-47888229 ATGGAAAACAGGTGGAGAGCTGG - Intergenic
1185042963 22:48515038-48515060 CAGATAAGCAGGTGCAGAGCTGG + Intronic
1185042978 22:48515156-48515178 CAGATAAGCAGGTGCAGAGCTGG + Intronic
1185042994 22:48515274-48515296 CAGATAAGCAGGTGCAGAGCTGG + Intronic
1185310039 22:50149266-50149288 GTGAGACGCAGGTGGAGAGCAGG + Intronic
950135411 3:10577403-10577425 CGGCAAGACAGGAGCAGAGCTGG + Intronic
952993711 3:38856111-38856133 CAGAAACACAATTGCAGTGCTGG + Intronic
953447566 3:42980662-42980684 CTGGAACAGAGGTGGAGGGCTGG + Intronic
954187239 3:48926937-48926959 CTGAAAAATAGGTGCATAGTTGG - Intronic
957921722 3:86757318-86757340 CAGAGACACAGTTGCAGTGCTGG - Intergenic
959495609 3:107047862-107047884 CTGAAAGCCCAGTGCAGAGCTGG - Intergenic
961134235 3:124495173-124495195 CTGACACACAGAAGCACAGCTGG + Intronic
962153714 3:132921556-132921578 CTAAAACACAGGTAGACAGCAGG + Intergenic
962928446 3:140016069-140016091 CTGTTACACAGGTGCAGAAATGG + Intronic
966372915 3:179267011-179267033 CGGAAACACAGGTGATGAGGTGG - Intergenic
967286891 3:187880418-187880440 CTGAAATAAAGGTGAGGAGCAGG - Intergenic
968403337 4:317215-317237 CTGACACACAGCTGGAGAGAAGG - Intergenic
971745460 4:30574309-30574331 GTGAAACACAGAAGCAGAGATGG + Intergenic
972018691 4:34280792-34280814 CAGAGACACAGGTGCAGTGCTGG - Intergenic
972189544 4:36573770-36573792 CTGAAACAAAGGTTTAAAGCAGG + Intergenic
972712606 4:41612718-41612740 CTGACCCACATGTTCAGAGCAGG - Intronic
973001661 4:44959521-44959543 GTGAAACACAGAAACAGAGCGGG - Intergenic
973022992 4:45226726-45226748 CTGCAACTCATGTGCACAGCAGG - Intergenic
973639466 4:52888414-52888436 GGGAAACAGAGGTGCAGAGCAGG - Intronic
976222487 4:82768889-82768911 CTGAAAAATTGATGCAGAGCTGG - Intronic
978275517 4:106944846-106944868 CTGAAACACCTGGGCACAGCAGG + Intronic
979572942 4:122251918-122251940 CTGGAGCTCAGGTGAAGAGCTGG - Intronic
980212504 4:129807910-129807932 CTGAAAAACAGGTTTATAGCTGG - Intergenic
985325779 4:188768378-188768400 AAGGAACACAGTTGCAGAGCTGG - Intergenic
985899430 5:2777127-2777149 CTGAACCACGGGAGCAGAGCTGG + Intergenic
987319018 5:16750360-16750382 TTGAAAAACAGGTGCAAAGGAGG - Intronic
987587025 5:19868293-19868315 CTGAAATAAAGCTGAAGAGCTGG - Intronic
988545966 5:32157590-32157612 CAGAAACACAGGTACAGATATGG - Intronic
989301535 5:39900348-39900370 TGGAGACACAAGTGCAGAGCAGG - Intergenic
989451926 5:41596744-41596766 CTGAGACACTGGAGCATAGCGGG + Intergenic
991005474 5:61823970-61823992 CTCAAACACTTGTGCAGATCAGG + Intergenic
991086682 5:62654099-62654121 CTGAAGCTCAGGTACACAGCTGG - Intergenic
993099375 5:83518510-83518532 CTGAAACACAAATGTAGAACAGG - Intronic
993864761 5:93179088-93179110 TTGAAACACATGTGCATATCTGG - Intergenic
994606333 5:101972017-101972039 CTGAAACACTCATGCAGTGCTGG - Intergenic
994857063 5:105135933-105135955 CTGATTCACAGGTTCACAGCTGG + Intergenic
998133985 5:139665209-139665231 CTCACACACAGGCGCAGAGAGGG - Intronic
999377401 5:151096225-151096247 CTGAAGCAAAGGCGCAGAGCTGG - Intergenic
999454901 5:151707110-151707132 CTGAATCACAGCTTCAGAGAGGG - Intergenic
1000237652 5:159377264-159377286 CAGAGACACAGTTGCAGAGCTGG + Intergenic
1001210941 5:169809636-169809658 CTGAGCCACAGGTGTAGAGCAGG + Intronic
1001450986 5:171824257-171824279 CTCAAACTCAGGTACAGAGCAGG - Intergenic
1003194957 6:3906314-3906336 CTGAAACACAGGTGTCCCGCTGG - Intergenic
1004485283 6:16060534-16060556 CTGCAACACAGGTACAGAAATGG + Intergenic
1005009526 6:21322721-21322743 CTGCCAGAAAGGTGCAGAGCAGG + Intergenic
1005125146 6:22438396-22438418 CTGAAATACAGCAGCAGTGCTGG - Intergenic
1005434591 6:25794931-25794953 CTGACACACTGCTGCAAAGCGGG - Intronic
1006927812 6:37667796-37667818 CTGAAAAAGAGCTGGAGAGCTGG + Intronic
1007320734 6:41027390-41027412 CTGAAACACAGGTGCAGAGCGGG + Exonic
1008443663 6:51562094-51562116 GTGAAACAGAGGTGCATAGAAGG + Intergenic
1010084870 6:71905391-71905413 CTGAAACACATGGCCACAGCTGG + Intronic
1011163766 6:84422409-84422431 CTCAACCACTGGTGCAGAGAAGG + Intergenic
1011648700 6:89485412-89485434 CTCAAAAGCAGGTGCAGAGCTGG + Intronic
1011670136 6:89675294-89675316 CTGAAAGCAAGGGGCAGAGCTGG + Intronic
1011696967 6:89921564-89921586 CTTAAACATGGGTCCAGAGCAGG + Intergenic
1012997643 6:105989652-105989674 CAGAAACTCAGCTGCAGAGAGGG + Intergenic
1013381214 6:109573223-109573245 CTGGCACACAGGAGCACAGCTGG - Intronic
1015455769 6:133424699-133424721 CTGACCCACAGCTGCAGACCTGG - Intronic
1015962561 6:138665475-138665497 CTGAACCAAAGGTGCTGAGCAGG - Intronic
1016428044 6:143955312-143955334 CTGGAATACAGGTGCAGATGTGG + Intronic
1017949694 6:159126340-159126362 CTGGAACACAGATGCCAAGCAGG - Intergenic
1019094122 6:169564918-169564940 CGCAACCACAGGTGCAGAACGGG + Intronic
1019219292 6:170462000-170462022 CTGTTCCCCAGGTGCAGAGCAGG + Intergenic
1020091663 7:5345453-5345475 CAGAGATGCAGGTGCAGAGCTGG - Intronic
1020203280 7:6096608-6096630 GGGAAGAACAGGTGCAGAGCAGG + Intergenic
1023204417 7:37732739-37732761 ATGTAACAAAGGAGCAGAGCAGG + Intronic
1023510313 7:40945625-40945647 CAGAGCCACAGGTGCAGTGCTGG - Intergenic
1024284723 7:47747253-47747275 CTCAAACAGAGGTTCAGAGTAGG - Intronic
1026827488 7:73593652-73593674 CTGGAGCACAGTGGCAGAGCAGG + Exonic
1027716431 7:81676917-81676939 TTGAAACTCAGGCTCAGAGCTGG - Intergenic
1029147589 7:98457883-98457905 CTGCAGCACAGATGCTGAGCTGG + Intergenic
1029716165 7:102327787-102327809 GTGAACCCCAGGGGCAGAGCTGG - Intergenic
1030187768 7:106780178-106780200 CAGCATCACAGGTGCTGAGCTGG - Intergenic
1032329382 7:130963476-130963498 CTGAAACAAAGGTGCGGGGGAGG - Intergenic
1032410715 7:131691873-131691895 CTGAAAGGCAGGGGCAGGGCAGG - Intergenic
1033709579 7:143927815-143927837 CTGAAACACTGGAGTAGACCAGG + Intergenic
1035684779 8:1515216-1515238 CTGAAACTCAAGTGCAGGGTGGG - Intronic
1037073626 8:14684855-14684877 CTGAAACACATGTGTGGAGGAGG + Intronic
1038399563 8:27272671-27272693 CAGAAACCCACGTGCAGTGCAGG + Intergenic
1038415876 8:27395573-27395595 CAGGCACAGAGGTGCAGAGCTGG - Intronic
1039392772 8:37195250-37195272 CTGCAGCAAGGGTGCAGAGCAGG + Intergenic
1039410418 8:37350196-37350218 CTGAAAGAAAGCTGCATAGCTGG - Intergenic
1039603755 8:38864425-38864447 CAGCAAGACAGGTGCAGAGTTGG - Intergenic
1040862383 8:52012736-52012758 CTGAGAGGGAGGTGCAGAGCTGG + Intergenic
1041626489 8:60034713-60034735 CTGAAACACAAGTGGAGGGCTGG - Intergenic
1042493218 8:69426246-69426268 CTGACAAACACCTGCAGAGCAGG + Intergenic
1042840289 8:73116773-73116795 CTGGCACACAAGTGCAGAGGAGG + Intronic
1046284723 8:112079928-112079950 CAGAGGCATAGGTGCAGAGCTGG - Intergenic
1046524199 8:115363252-115363274 CTGAAACACAAGTGGAGAAGTGG + Intergenic
1047022181 8:120786344-120786366 CAGAGATACAGGTGCAGTGCTGG + Intronic
1050555515 9:6786143-6786165 CAGAAACACAGGTGTAGACAGGG + Intronic
1050891499 9:10830078-10830100 CTGAAACACACATGCAGAATGGG + Intergenic
1053003325 9:34589715-34589737 CTGAAGAGCCGGTGCAGAGCGGG - Exonic
1053103577 9:35391592-35391614 CTGTAACACAAGCCCAGAGCAGG + Intronic
1054745646 9:68851846-68851868 CTGGAAAGCAGCTGCAGAGCCGG + Intronic
1056111215 9:83396924-83396946 GTGAAACACAGTTGCAGAGATGG + Intronic
1057126183 9:92617891-92617913 CAGAAACAGTAGTGCAGAGCTGG + Exonic
1057914417 9:99044675-99044697 CAGAAACAAAGATGCAAAGCTGG - Intronic
1059581104 9:115549342-115549364 CTGAAATAGAGGTGGAGAGGAGG + Intergenic
1059937238 9:119323313-119323335 CTGAAACCCAGCAGCAGAGCAGG + Intronic
1060971469 9:127740601-127740623 CTGAAAAAAAGTGGCAGAGCTGG + Intronic
1061205255 9:129159332-129159354 CTGAACAACAGGTGCTGACCAGG + Intergenic
1061241711 9:129378391-129378413 CAGAAGCACAGGTGCAGGGAAGG - Intergenic
1062032527 9:134368127-134368149 CAGAGACACAGGTGCATGGCAGG - Intronic
1062351926 9:136143616-136143638 CGGAAGCACAGGGGCAGATCCGG - Intergenic
1187328002 X:18309623-18309645 CTGTAACACAGATGGAGAGCTGG + Intronic
1188623782 X:32258775-32258797 CTGGGACACACGTGCAGAACGGG - Intronic
1192511037 X:71720503-71720525 CTGAAACAGAGAGGCAGAACCGG - Intergenic
1192515660 X:71761050-71761072 CTGAAACAGAGAGGCAGAACCGG + Intergenic
1192528868 X:71869804-71869826 CTGAAACAGAGAGGCAGAACCGG + Intergenic
1192682667 X:73267962-73267984 CAGAATTACAGGTGCAGTGCTGG + Intergenic
1193839516 X:86392002-86392024 CTGAGATACATGTGCAGAACGGG + Intronic
1194181540 X:90716361-90716383 CAGAAACACAATTGCAGTGCTGG + Intergenic
1195779605 X:108447146-108447168 CTGAAAGACAGCTACAGTGCAGG - Intronic
1196001344 X:110790260-110790282 CTGAAACACTGGACCAGATCTGG + Intronic
1197277954 X:124501851-124501873 CTGAAAGGCAGCAGCAGAGCTGG + Intronic
1197599025 X:128505267-128505289 CTGAGAAACAGGGGAAGAGCTGG + Intergenic
1198894054 X:141431025-141431047 CTGCAACCCAGGTCCAGACCTGG + Intergenic
1199332700 X:146581228-146581250 CAGAGACACAGTTGCAGTGCTGG - Intergenic
1199595885 X:149505389-149505411 CCGAGAGACAGGCGCAGAGCGGG + Intronic
1199737312 X:150696016-150696038 AGGAAACACAGGAGCAGAGTAGG + Intronic
1200528165 Y:4298276-4298298 CAGAAACACAATTGCAGTGCTGG + Intergenic
1201798820 Y:17931034-17931056 CTGAAACAAAATTGCAGAGCAGG + Intergenic
1201802733 Y:17974923-17974945 CTGAAACAAAATTGCAGAGCAGG - Intergenic
1202360123 Y:24099650-24099672 CTGAAACAAAATTGCAGAGCAGG + Intergenic
1202510654 Y:25570464-25570486 CTGAAACAAAATTGCAGAGCAGG - Intergenic