ID: 1007323013

View in Genome Browser
Species Human (GRCh38)
Location 6:41040732-41040754
Sequence CCCTCTTTAGGGCGGCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007323002_1007323013 4 Left 1007323002 6:41040705-41040727 CCAACAGACAGGGACACTCTCCC 0: 1
1: 1
2: 3
3: 16
4: 262
Right 1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007323013 Original CRISPR CCCTCTTTAGGGCGGCTGGG AGG Intronic
901075909 1:6554565-6554587 CCCTCTTTTCGGCAGCTGGGAGG - Intergenic
901820296 1:11824835-11824857 CTCTATATAGGGTGGCTGGGTGG + Intronic
902370887 1:16006159-16006181 CCCTCTGCAGAGCGGCAGGGTGG - Exonic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
904302237 1:29561778-29561800 CCCTCCTTAGGGTGGCTGTGAGG - Intergenic
904566715 1:31432702-31432724 TCCTCTAGAGGGCTGCTGGGGGG - Intronic
905502291 1:38449330-38449352 CCCTCTGAAGGGCTGCTGGGTGG - Intergenic
916605299 1:166336323-166336345 CCTTCTCCAGGGCGGCTGGCTGG + Intergenic
920907734 1:210187810-210187832 CCTTCTTAAGGGCGGAGGGGTGG - Intergenic
1062791255 10:307901-307923 CCCTCTGGAGGGCAGCAGGGAGG + Intronic
1064409543 10:15093118-15093140 CCCTCTTCAGGGCGTCTGCGTGG + Intergenic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1067568144 10:47352648-47352670 CCCTCTCTAAGGCTGCTGGAGGG - Intronic
1075614265 10:123880148-123880170 CCCTGTTCAGGGAGGGTGGGTGG - Intronic
1075623171 10:123942697-123942719 CCCTCCTGAGGGCTGCTGGCTGG - Intergenic
1079005480 11:16788824-16788846 CCCTCTCCATCGCGGCTGGGAGG + Exonic
1079450744 11:20598158-20598180 CCCTCTAAAGGGCAGCTGGCTGG - Intergenic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1084757574 11:71249469-71249491 CCCTCCTTGGGGCAGCAGGGAGG - Intronic
1085741707 11:79082911-79082933 CCCTCTTTCCAGCAGCTGGGTGG + Intronic
1089795851 11:120980285-120980307 CCCTGTCGAGGGAGGCTGGGTGG - Intronic
1090635736 11:128689619-128689641 TGCTGTTTGGGGCGGCTGGGAGG + Intronic
1092522004 12:9284940-9284962 CCCTCTTCAGGTTGGCTGTGTGG - Intergenic
1092545278 12:9446916-9446938 CCCTCTTCAGGTTGGCTGTGTGG + Intergenic
1094507671 12:31075134-31075156 CCCTCTTCAGGTTGGCTGTGTGG - Intronic
1096808498 12:54155211-54155233 CCCTCCTTGGAGCAGCTGGGAGG - Intergenic
1097733240 12:63152164-63152186 CCCTCTGCAGGGCGGGAGGGAGG + Intergenic
1107428394 13:40316699-40316721 CACTCTCTAGGGGGGCCGGGGGG + Intergenic
1115761834 14:36583392-36583414 CCCGCTTTAGAGCCCCTGGGCGG + Intergenic
1118541963 14:66837686-66837708 CCCTCTTTAGTGCTACTGTGTGG - Intronic
1118727941 14:68643745-68643767 CCCTTTTTAGGAGGTCTGGGAGG + Intronic
1120891146 14:89492339-89492361 CCATCTTTGGGGTGGGTGGGAGG - Intronic
1122176667 14:99925890-99925912 CCATCTCTAGGGCAGTTGGGTGG - Intronic
1125316748 15:38440682-38440704 CCCTGATGAGGGCGGCTGGCAGG + Intergenic
1127582721 15:60352323-60352345 CCCTGGCTGGGGCGGCTGGGTGG - Intronic
1127932746 15:63607860-63607882 CCATCTTGAGAGCAGCTGGGAGG - Intergenic
1131803881 15:96101254-96101276 CCCTCTTGAGGGCACATGGGAGG + Intergenic
1132831218 16:1929456-1929478 CCTTCTTCAGGGCAGCTGCGTGG - Intergenic
1137036918 16:35575662-35575684 GCCTCATTAGGGCCGCTGTGGGG - Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1141464185 16:84195735-84195757 CCCTCGGTTGGGCTGCTGGGTGG + Intronic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142194910 16:88734863-88734885 CCCTCTTCCAGGTGGCTGGGGGG - Exonic
1142472695 17:172153-172175 CACTCCTCAGGGCGTCTGGGAGG + Intronic
1146129480 17:30259008-30259030 CCCTCTTTAGGGAGGATGTTAGG - Intronic
1147358653 17:39917583-39917605 CCTTCTTAAGGGCGGCGGCGGGG - Intronic
1147692414 17:42324663-42324685 CCCTTTTCTGGGCGGGTGGGCGG + Intronic
1148347358 17:46912357-46912379 CCCTCCTCAGGGCTGCTGGTAGG + Intergenic
1150161840 17:62905048-62905070 ACCTCTTTTGGGTGGGTGGGAGG + Intergenic
1150646023 17:66977961-66977983 GCCTCCTTAGGGCGTCCGGGAGG - Intronic
1151658847 17:75508193-75508215 CCCTCTGCAGAGCTGCTGGGTGG - Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1156232498 18:35167550-35167572 CCCTCTCTAGGTCAGCTGGCTGG - Intergenic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1162149313 19:8633635-8633657 CCATCCTCAGGGCGGCTGGAGGG - Intergenic
1162344708 19:10112466-10112488 CCCTCCTTCGGGAGGATGGGGGG - Intronic
1163440900 19:17322175-17322197 CGCTCTGCAGGGCTGCTGGGCGG + Exonic
1164065336 19:21709728-21709750 CCCTCTTTCTGCCGGCAGGGCGG - Intergenic
1164507764 19:28873612-28873634 CACCCTTTAGGGCTGTTGGGAGG + Intergenic
1167247307 19:48381365-48381387 CCCTCTGTAGGGATGCTGTGAGG + Intergenic
1167486542 19:49766530-49766552 CCCTCCATTGGGCGGCTGTGGGG - Intergenic
1167517033 19:49929458-49929480 CCCTCTTTAGGGAGCCCTGGGGG + Exonic
1168292740 19:55364849-55364871 CCCTGCTCCGGGCGGCTGGGTGG + Exonic
1168650061 19:58087033-58087055 CCTTCTCTAGGGCAGGTGGGAGG - Intronic
925174901 2:1775845-1775867 CCCTCTTTAGGGCTGATGTCCGG + Intergenic
929098509 2:38286513-38286535 CCCTCTTCAGGGGGTCTGGATGG - Intergenic
936983493 2:118286307-118286329 TCCTCTTTAGAGCTGCTTGGGGG + Intergenic
938324694 2:130390776-130390798 CCTTGTTTAGGGCGGCTGAGTGG + Intergenic
941110579 2:161415905-161415927 CCCCCTTTAGAGCGGAGGGGCGG - Intergenic
943775245 2:191758568-191758590 GCCTCTATAGGGCCGCTTGGGGG + Intergenic
944242656 2:197500508-197500530 CCCTCTTTTGTTGGGCTGGGCGG + Intronic
945241518 2:207681347-207681369 CATTCTTTAGGGCGGCCGCGGGG + Intergenic
946236466 2:218327368-218327390 GCCTCATTCGGGGGGCTGGGAGG - Intronic
948762760 2:240202942-240202964 CCCTCACTAGGGCCTCTGGGAGG + Intergenic
948949028 2:241236943-241236965 CCCTCTTTGAGGCTGCTGTGGGG - Intronic
1171489095 20:25504147-25504169 CCCTGGTGAGGGCGGTTGGGTGG - Intronic
1171968470 20:31548631-31548653 CCCTTCTTAGGGCTGCTGTGGGG - Intronic
1171981798 20:31633736-31633758 CCTTTTTCAGGGTGGCTGGGAGG - Intergenic
1173260385 20:41429825-41429847 CCCTCTTTAGCGGGGCTGTCAGG - Intronic
1174639486 20:52031150-52031172 CACTTTTCAGGGAGGCTGGGTGG - Intergenic
1181943409 22:26496533-26496555 CCCTCCTGAGGGTGGCTTGGGGG + Intronic
951606387 3:24439296-24439318 CCCTGTTAAGGGGGCCTGGGTGG + Intronic
956892380 3:73625046-73625068 CCCTTTTTCGGGGGGCTGGCGGG - Intergenic
958804656 3:98795276-98795298 CCCTCTTTAGAGAGGCAGGTTGG - Exonic
962084357 3:132174462-132174484 CCCTGTCAAGGGTGGCTGGGAGG - Intronic
968660571 4:1797173-1797195 CCCTTCCTAGGGCTGCTGGGGGG + Intronic
975633108 4:76421359-76421381 CACTCCTTAGGGCGCCCGGGCGG - Intronic
976389753 4:84496528-84496550 ACCTCCTTAGTGCGGCTGAGCGG - Intronic
981076258 4:140595375-140595397 CCCTGCTGAGGGTGGCTGGGAGG + Intergenic
989377758 5:40782847-40782869 CCTTCTTTTGGGTGGTTGGGGGG - Intronic
993713968 5:91256170-91256192 CTTTCTTTAGGGGGGCAGGGTGG + Intergenic
993907852 5:93643280-93643302 CCCTCTTTTGGTAGGCTGAGGGG - Intronic
997675935 5:135713429-135713451 GCCTCATCAGGGCTGCTGGGAGG - Intergenic
998397291 5:141826820-141826842 CTGTCTCTAGGCCGGCTGGGAGG + Intergenic
999370707 5:151053435-151053457 TCCTCTATAGGGCTGCTGAGAGG + Intronic
1004785498 6:18963632-18963654 GCCTCTGTAGGGTGGCTGGTGGG - Intergenic
1006422671 6:33945135-33945157 CCCTCTTTAGGGCCTCTGTGAGG + Intergenic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1020009208 7:4799365-4799387 CCCTCTCTAGGGGGGCTGCGAGG - Exonic
1022532692 7:31076793-31076815 CTCCCCTTAGGGCGGATGGGGGG + Intronic
1023929236 7:44694955-44694977 CCCTCTCTAGGGCAGCTGCTTGG - Intronic
1024046980 7:45591648-45591670 CCCTCTTCAGGGCCTCTGGCAGG + Intronic
1025810483 7:64872389-64872411 GCCTCTTTGGGGCGTCTCGGTGG - Intronic
1025947342 7:66114765-66114787 CCCTTTTTCGGGGGGCAGGGTGG - Exonic
1033850392 7:145488142-145488164 TCCCCTTTTGGGAGGCTGGGAGG + Intergenic
1036939709 8:13039794-13039816 ACCTTTATAGGGCTGCTGGGAGG + Intergenic
1037892121 8:22628945-22628967 CCCACTCTGGGGAGGCTGGGGGG + Intronic
1042377101 8:68064362-68064384 CACTCTTTTGGGGGGTTGGGGGG + Intronic
1048496319 8:134939044-134939066 CCCTCTTTAGGGAGGTGGGCGGG + Intergenic
1049708939 8:144055095-144055117 CCCTCTTTGGGCCCGATGGGGGG - Exonic
1062448766 9:136606835-136606857 CCCTCAAGAGGGCGGCTGGCTGG - Intergenic
1186219679 X:7336242-7336264 CCTCCTTTGGGGCGGGTGGGGGG - Intronic
1186788754 X:12976380-12976402 CCATCTTTAGAAAGGCTGGGTGG + Intronic
1187141774 X:16600927-16600949 TCCTCCTTAGGGCCGCTGTGAGG - Intronic