ID: 1007323895

View in Genome Browser
Species Human (GRCh38)
Location 6:41045880-41045902
Sequence CAGGTCACAGGCACCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 294}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007323886_1007323895 6 Left 1007323886 6:41045851-41045873 CCACCAAGGGCATGCTCAGCCCA 0: 1
1: 0
2: 1
3: 26
4: 192
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323883_1007323895 13 Left 1007323883 6:41045844-41045866 CCCTCCTCCACCAAGGGCATGCT 0: 1
1: 0
2: 1
3: 27
4: 242
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323887_1007323895 3 Left 1007323887 6:41045854-41045876 CCAAGGGCATGCTCAGCCCAGTG 0: 1
1: 0
2: 0
3: 27
4: 544
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323882_1007323895 14 Left 1007323882 6:41045843-41045865 CCCCTCCTCCACCAAGGGCATGC 0: 1
1: 0
2: 11
3: 924
4: 3236
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323881_1007323895 17 Left 1007323881 6:41045840-41045862 CCTCCCCTCCTCCACCAAGGGCA 0: 1
1: 0
2: 3
3: 54
4: 588
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323885_1007323895 9 Left 1007323885 6:41045848-41045870 CCTCCACCAAGGGCATGCTCAGC 0: 1
1: 0
2: 1
3: 15
4: 202
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294
1007323884_1007323895 12 Left 1007323884 6:41045845-41045867 CCTCCTCCACCAAGGGCATGCTC 0: 1
1: 0
2: 1
3: 27
4: 279
Right 1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG 0: 1
1: 0
2: 2
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007323895 Original CRISPR CAGGTCACAGGCACCCCAGG AGG Intronic
900539067 1:3193787-3193809 CAGGTCTCAGGCACCCGGGAAGG - Intronic
900686996 1:3954947-3954969 CAGGTGACAGGAGCCCCGGGGGG - Intergenic
900752725 1:4408969-4408991 CAGGACACAGGCTCCCCAAAGGG - Intergenic
900978631 1:6033903-6033925 CAGGTCACACGCAGACCAAGTGG + Intronic
901006194 1:6172740-6172762 CAGGTCACAGGTCCCTCAAGGGG + Intronic
901136139 1:6997589-6997611 CATGTCACAGGAGACCCAGGAGG - Intronic
901323155 1:8351454-8351476 CTGGCCACAGGAGCCCCAGGTGG - Intergenic
902361644 1:15945318-15945340 CAGTTCACAGGCCCCCCCGGGGG - Intronic
902396210 1:16133624-16133646 GGGGTCACAGGCAGCTCAGGAGG + Intronic
902531531 1:17093790-17093812 CAGGTCACAGCTGCCCCAGTGGG - Intronic
902931470 1:19734598-19734620 CACGTAAGAGGCCCCCCAGGTGG - Intronic
903235947 1:21950954-21950976 CAGGGCACTGGCACCCCTGAGGG + Intergenic
904470575 1:30733658-30733680 CAGCTCACAGGCCCTGCAGGAGG + Exonic
905775045 1:40663028-40663050 CAGTTCACACACACCCCAGCTGG + Intronic
906127519 1:43436546-43436568 CAGCACACAGGCTACCCAGGAGG - Intronic
911044131 1:93614888-93614910 CAGGTCGCAGGGAATCCAGGAGG - Intronic
912277189 1:108272509-108272531 CAGGGCAGAGGCTCCTCAGGAGG + Intergenic
912291039 1:108421847-108421869 CAGGGCAGAGGCTCCTCAGGAGG - Intronic
912554078 1:110503654-110503676 CCAGACACCGGCACCCCAGGAGG - Intergenic
913255482 1:116949545-116949567 CAGGTCACACCCACACCAGCTGG - Exonic
914937829 1:151995295-151995317 CAGGTCACAGTCACCAGTGGAGG + Intergenic
915024109 1:152811359-152811381 GAGGTCACAAGCAGCACAGGAGG - Intronic
915487007 1:156228560-156228582 CAGGTCACAGCCAGCGCTGGTGG + Intronic
915529487 1:156495041-156495063 CAGCTCACAGGGACAGCAGGAGG + Intronic
916107377 1:161441567-161441589 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
916108962 1:161448985-161449007 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
916110550 1:161456366-161456388 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
916112135 1:161463776-161463798 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
916113722 1:161471157-161471179 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
916121258 1:161530368-161530390 CAGGTCGCAGTCTCCCCTGGAGG - Intergenic
916214745 1:162385162-162385184 GAGGCCACAGGAATCCCAGGAGG - Intronic
916333997 1:163649337-163649359 TAGGTCACAGGCACACATGGAGG - Intergenic
917136275 1:171791245-171791267 CAGAGCACAGCCACCACAGGGGG - Intronic
917456877 1:175193045-175193067 AAGGCCAGAGGCACCCGAGGTGG - Intergenic
917496215 1:175542358-175542380 CTGGCCACAGGAACCCGAGGTGG - Intronic
918210799 1:182349339-182349361 CAGGTTACAGGCCTCCCATGAGG - Intergenic
921293281 1:213678507-213678529 AAGGTCAGAGGCTCCCCAGAGGG + Intergenic
922223486 1:223626449-223626471 CTGGTCACAGGAGCCCGAGGTGG + Intronic
922817911 1:228464122-228464144 CAGGTCACAACCAGACCAGGTGG + Intergenic
1062822909 10:548239-548261 CAGGGCTCAGGGCCCCCAGGTGG + Intronic
1062982930 10:1740394-1740416 TAGATCACAAGCACCACAGGAGG + Intergenic
1064078189 10:12287060-12287082 CTGGTCAGAAGCACCTCAGGAGG + Intergenic
1065957429 10:30705830-30705852 CAAGTCTCAGGAAACCCAGGAGG - Intergenic
1067058713 10:43066808-43066830 CAGCTCACAGCATCCCCAGGTGG - Intergenic
1068424595 10:56843507-56843529 CAGGTGAGAGGCACCCCACCTGG - Intergenic
1069539229 10:69281161-69281183 CAGGTCACAGAATCACCAGGAGG + Intronic
1070781968 10:79142849-79142871 CAGGTCACATGCTGCCCATGGGG + Intronic
1070787299 10:79169274-79169296 CAGGGGGCTGGCACCCCAGGTGG - Intronic
1070798508 10:79231027-79231049 CAGAGCAAAGGCACCCCAGGAGG - Intronic
1070923133 10:80201561-80201583 CATGTCTCAGGGACACCAGGTGG + Intronic
1071816688 10:89239536-89239558 CAGGTCACCTGCTCCCCAGCAGG - Intronic
1073964211 10:108969804-108969826 AAGGTTACTGGAACCCCAGGAGG + Intergenic
1076495200 10:130892654-130892676 CAGGTCACAGGCTCACTGGGAGG + Intergenic
1076629072 10:131841889-131841911 CAGGCACCTGGCACCCCAGGAGG - Intergenic
1076636035 10:131882445-131882467 CAGGGCACACTCATCCCAGGGGG + Intergenic
1077344361 11:2039508-2039530 CAGGGCACAGGCACCTCCTGTGG + Intergenic
1079004741 11:16783650-16783672 CAGGTCACCCTGACCCCAGGTGG - Intronic
1081026244 11:38018988-38019010 CAGGCCTCAGGAACCCCAGTAGG + Intergenic
1083970123 11:66069810-66069832 CGGATCACAGGCACCCGCGGTGG + Intergenic
1084207657 11:67605340-67605362 CAGGTCAGAGCCAGCCCAGCGGG - Intronic
1084267046 11:68010462-68010484 CGGGTTACAGGCAGCCCAGGCGG + Intronic
1084652885 11:70499426-70499448 CAGGCCACAGGCGCCCACGGTGG + Intronic
1084748565 11:71189006-71189028 CAGGTCACAGCAACCACAGACGG + Intronic
1086948208 11:92865379-92865401 CAGGTCACAAACAGCCAAGGAGG - Intronic
1088740393 11:112762340-112762362 CAGGTCCCATGCAGCCCTGGAGG + Intergenic
1088990697 11:114950857-114950879 GAAGTCCCAGGCACTCCAGGTGG - Intergenic
1089884125 11:121803013-121803035 CAAGTCACAGGAAGCCAAGGGGG - Intergenic
1090255548 11:125281195-125281217 CAGCTCAGAGCCACCTCAGGAGG + Intronic
1090712464 11:129399951-129399973 CAGGGCTCAGACACCACAGGTGG - Intronic
1090907567 11:131090427-131090449 CAGGGAACAGACACCCCAAGGGG + Intergenic
1202827347 11_KI270721v1_random:94697-94719 CAGGGCACAGGCACCTCCTGTGG + Intergenic
1091846090 12:3657339-3657361 CATATGACAGGAACCCCAGGGGG - Intronic
1091973814 12:4809693-4809715 CGGGTCTCAGGCACCGCTGGGGG + Exonic
1095871385 12:47031908-47031930 CAGGTGACAGGTGCCCAAGGTGG + Intergenic
1096606492 12:52769986-52770008 CATGTCACCACCACCCCAGGAGG - Intronic
1097402702 12:59148929-59148951 CAGATCACAGGGACACCAAGAGG - Intergenic
1102495174 12:113314654-113314676 TAGGCCACAGGCACCCCATAGGG + Intronic
1103746372 12:123127276-123127298 CAGGTCGCAGGGGACCCAGGAGG + Intronic
1103965662 12:124637871-124637893 CACTTCCCAGCCACCCCAGGGGG + Intergenic
1104972240 12:132537096-132537118 CAGAGCACAGGGGCCCCAGGTGG + Intronic
1104997671 12:132668693-132668715 GAAGTCACAGGCAGCACAGGTGG + Exonic
1107045053 13:35984933-35984955 CAGGGCACTGCCACACCAGGAGG - Intronic
1113083865 13:106547151-106547173 CATGGCACAGGCATCCCATGAGG - Intronic
1113472916 13:110559478-110559500 CAGGCCACAGGCCACCGAGGAGG + Intronic
1113904462 13:113812843-113812865 TGGGTCACAGGCATCCCGGGTGG + Exonic
1114621743 14:24100165-24100187 GAGGTCACAGTAACACCAGGTGG - Exonic
1117475208 14:56087490-56087512 TAGGTCACAGACACTGCAGGAGG - Intergenic
1119263889 14:73253235-73253257 CAGGTCACAGGCTCCCCGCAGGG + Intronic
1120163472 14:81170007-81170029 CAGGTTGCAGGGAGCCCAGGGGG + Intergenic
1121273109 14:92651076-92651098 CACATCACAGGCACACGAGGAGG - Intronic
1121667455 14:95684146-95684168 CAGGTCACAGGTACCAGAGATGG + Intergenic
1121955602 14:98210100-98210122 GAGGTCACAGGGACCCCAGATGG - Intergenic
1123421175 15:20138578-20138600 CAGGTAGCTGGGACCCCAGGTGG + Intergenic
1123530400 15:21145114-21145136 CAGGTAGCTGGGACCCCAGGTGG + Intergenic
1123940642 15:25215005-25215027 CAGGTCACGGCCAACCAAGGAGG - Intergenic
1123941345 15:25218102-25218124 CAGGTCACAGCCAACCAAGGAGG - Intergenic
1123945190 15:25235552-25235574 CAGGTCACGGCCAACCAAGGTGG - Intergenic
1123946471 15:25241214-25241236 CAGGTCACAGCCAACGAAGGAGG - Intergenic
1125766923 15:42142333-42142355 CAGCTCTCAGACCCCCCAGGAGG + Intronic
1126822663 15:52520241-52520263 CAGCTCACAGCCATCCCATGAGG + Intronic
1128053593 15:64683708-64683730 CACCTCACAGGAGCCCCAGGAGG - Exonic
1128084845 15:64878714-64878736 CCTGCCACAGGCACCCCAGGTGG - Intronic
1129221690 15:74135027-74135049 CTGCTCCCAGGCACCCTAGGTGG - Exonic
1129690411 15:77710119-77710141 CAGGCCTCTGGAACCCCAGGGGG + Intronic
1130296205 15:82648178-82648200 TAGGTCTCTGGCCCCCCAGGGGG - Intronic
1131032323 15:89196506-89196528 CAGCTCCCAGGCTCCCCTGGAGG - Exonic
1132230990 15:100184171-100184193 CAGGTCTCAGGCTCCCCATGTGG + Intronic
1132666200 16:1082368-1082390 CAGGGCTCAGCCAGCCCAGGGGG - Intergenic
1132928361 16:2445289-2445311 CATGTCACAGGAAGCCCGGGAGG - Intronic
1132952292 16:2570067-2570089 CAGGCCAGAGACAGCCCAGGTGG - Intronic
1132962059 16:2630103-2630125 CAGGCCAGAGACAGCCCAGGTGG + Intergenic
1133234633 16:4382155-4382177 CGGGGCACAAGCACGCCAGGTGG - Exonic
1134511437 16:14851258-14851280 CCGGTCACTAACACCCCAGGAGG - Intronic
1134829857 16:17314239-17314261 CACGTCACTGGCTCCCCAGCAGG + Intronic
1134972754 16:18544919-18544941 CCGGTCACTAACACCCCAGGAGG + Intronic
1136349485 16:29697543-29697565 CAGGTCACAGGAGCAGCAGGTGG - Exonic
1138480545 16:57299985-57300007 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
1138480592 16:57300506-57300528 CAGGTCGCAGTCTCCCCTGGAGG - Intergenic
1139972517 16:70785077-70785099 CAGGGAACAGGAACCCCAGCGGG - Intronic
1141779896 16:86152423-86152445 CAGGGCTCAGCCACCCAAGGGGG + Intergenic
1141951020 16:87339460-87339482 CAGGTGACAAGCCCCACAGGAGG + Intronic
1142280046 16:89143284-89143306 CAGGACACAGGCAGCTCAAGAGG + Intronic
1142597392 17:1036235-1036257 AAGGCCACAGGCGCCCCAGTGGG + Intronic
1142750762 17:1986129-1986151 AAGGTCACAGGAAAACCAGGCGG + Intronic
1144673148 17:17144209-17144231 CAGGCCCCAGGCTCCCCTGGAGG - Intronic
1144888133 17:18477743-18477765 CAGGACACAGTCACCCCTGAAGG - Intronic
1145144072 17:20466560-20466582 CAGGACACAGTCACCCCTGAAGG + Intronic
1146400451 17:32496755-32496777 AAGGGCACAGGCCCTCCAGGAGG - Intronic
1148122242 17:45220316-45220338 AAGGTCACCAGCACCCCAGATGG - Intergenic
1148688856 17:49515305-49515327 CAAGTCAGAGGCTCGCCAGGAGG + Intergenic
1151335908 17:73439603-73439625 CAGGTCAAGGGGACCTCAGGGGG + Intronic
1151512646 17:74570695-74570717 CAGGTAACAGGAACCCCAGAGGG - Intergenic
1152366643 17:79860328-79860350 CAGGCCACAGACACCTCAGAGGG - Intergenic
1153229827 18:2925028-2925050 CAAGCCACAGGTTCCCCAGGTGG + Intronic
1153620752 18:6975311-6975333 CAGGTCACAGGCAGTCCACAGGG + Intronic
1154073782 18:11179288-11179310 CAGCTCACAGGAATCCCAGGAGG + Intergenic
1154492057 18:14930147-14930169 CAGGACACTGGCTCGCCAGGTGG + Intergenic
1155396522 18:25392069-25392091 AAGGTCACAGACACACCAAGGGG + Intergenic
1157456472 18:47834227-47834249 CAAGTCCCAGGCACACCAGAAGG - Exonic
1157815133 18:50724677-50724699 AAGGTCACTGGCCTCCCAGGAGG - Intronic
1160013337 18:75123204-75123226 AAAGTCACAGGCAGCACAGGCGG + Intergenic
1160084778 18:75766288-75766310 CAGTTCACAGGAATCTCAGGCGG + Intergenic
1160449492 18:78952672-78952694 CAGGTTCCAGCCACACCAGGCGG + Intergenic
1160764456 19:801221-801243 CAGCTGCCAGGTACCCCAGGAGG - Intronic
1161062372 19:2221739-2221761 CAGGGCACAGGCAGCCCAGATGG + Intronic
1161230566 19:3172886-3172908 CGGGGCACAGGCATCCCATGAGG - Intronic
1161230615 19:3173116-3173138 GAGGGCACAGGCATCCCATGAGG - Intronic
1161230647 19:3173252-3173274 GAGGGCACAGGCATCCCATGAGG - Intronic
1161230668 19:3173347-3173369 GAGGGCACAGGCATCCCATGAGG - Intronic
1161230673 19:3173366-3173388 GAGGTCACAGGCGTCCCATGAGG - Intronic
1161230696 19:3173480-3173502 GAGGGCACAGGCATCCCATGAGG - Intronic
1161230701 19:3173499-3173521 GAGGGCACAGGCATCCCATGAGG - Intronic
1161230867 19:3174230-3174252 GAGGGCACAGGCATCCCATGAGG - Intronic
1161231194 19:3175671-3175693 GAGGGCACAGGCATCCCATGAGG - Intronic
1161359380 19:3838718-3838740 CAGGCCACAGGGGCTCCAGGAGG - Intronic
1161408630 19:4103850-4103872 CAGGGCTCAGACAGCCCAGGAGG + Intronic
1161705492 19:5818945-5818967 CTGGTCACAGGACCCCCTGGAGG - Intergenic
1162341834 19:10096005-10096027 CCGGGCACAGGCGCTCCAGGCGG + Exonic
1162926541 19:13933110-13933132 CAGGTCACGGGCACCCAGCGCGG + Exonic
1163635350 19:18434789-18434811 CAGGCCCCAAGAACCCCAGGTGG + Exonic
1163762341 19:19144605-19144627 CTGGCCTCACGCACCCCAGGTGG - Intergenic
1164255408 19:23524024-23524046 TATGTCACAGTCACCCCAGTGGG + Intergenic
1164492612 19:28728384-28728406 CAGGTCACCAGGACACCAGGCGG + Intergenic
1164605052 19:29591889-29591911 CAGGGCACAGGAACCTCAAGGGG + Intergenic
1165634624 19:37330388-37330410 AAGGTGACAGGCAACCCTGGAGG - Intronic
1165722348 19:38088562-38088584 CTGGTCACAGACACCCCCAGTGG - Intronic
1165895969 19:39141132-39141154 CTGCTGACAGGGACCCCAGGAGG - Intronic
1165902248 19:39174335-39174357 CGGGGCACAGGGAACCCAGGAGG - Intronic
1166305353 19:41934478-41934500 CAGGTCACAGGCTGCCTGGGAGG + Intergenic
1166326526 19:42054267-42054289 CAGGACACGGCCACCTCAGGTGG - Intronic
1166504178 19:43361226-43361248 GAGGCCACAAGCACCCCAGGAGG - Exonic
1166506281 19:43373532-43373554 GAGGCCACAAGCACCCCAGGAGG + Intergenic
1166738542 19:45100458-45100480 GATATCACAGCCACCCCAGGAGG + Intronic
1167333960 19:48873335-48873357 GAGGTCCCAGGCCCCTCAGGCGG - Exonic
1167527643 19:49994923-49994945 GAAGACACAAGCACCCCAGGAGG + Intronic
925407047 2:3612786-3612808 CTGGTCACAGGCAGCCCCCGTGG + Intronic
925897886 2:8487459-8487481 CAGATCCCAGGCACTCCACGGGG + Intergenic
925914725 2:8596472-8596494 CAGGAAACAGGAACCCCTGGCGG - Intergenic
926136414 2:10339850-10339872 CAACGCACAGGAACCCCAGGAGG - Intronic
929469619 2:42178594-42178616 CACGTGACAGGCACCACACGGGG - Intronic
930326662 2:49928572-49928594 CAATTCACAAACACCCCAGGAGG - Intronic
935181366 2:100693641-100693663 CAGATCACAGCCAACCCTGGGGG + Intergenic
935215379 2:100971525-100971547 CAGGACCCAGGCACCCTATGGGG + Intronic
935229405 2:101082748-101082770 CAAGTCCCAGGCAACCCAGATGG - Intronic
935276466 2:101479988-101480010 GAGGCCACAGGCACCCGAGTCGG + Intergenic
936020236 2:108989105-108989127 CAGGTCCCAGGCAGCCCTGCTGG - Exonic
936531235 2:113278224-113278246 CAGGCCCCAGGCGCCCCAGCTGG + Intronic
938392846 2:130918518-130918540 CAGGCCACAGCCACCCCACGCGG + Intronic
938692704 2:133807107-133807129 CAGGTCCCAGGCACTACAGATGG + Intergenic
942314747 2:174687686-174687708 CAGTTCACAGGTATCACAGGTGG + Intergenic
943685729 2:190816033-190816055 AAGGTCACAGGTACTCAAGGAGG + Intergenic
946339482 2:219058636-219058658 CAGGACCCAGGCACACCAGGAGG - Intronic
946838478 2:223796357-223796379 CATTTCACAGGTACCCCAGAAGG + Intronic
947407398 2:229793775-229793797 CAGGCCACATGCAGCCCAGATGG + Intronic
947715695 2:232337913-232337935 CAGGGCTCAGCCACCTCAGGCGG + Intronic
947721230 2:232370290-232370312 CAGGGCTCAGCCACCTCAGGCGG + Intergenic
947734725 2:232448673-232448695 CAGGGCTCAGCCACCTCAGGCGG + Intergenic
948388166 2:237594567-237594589 CAGGCCACATCCTCCCCAGGGGG - Intronic
948666237 2:239536395-239536417 CAGACCACAGGCTCCCCAGGCGG - Intergenic
948766955 2:240227295-240227317 CAGGGCACCAGCACACCAGGCGG + Intergenic
948805307 2:240451374-240451396 GGGGCCACAGGCACCCAAGGAGG - Intronic
948815367 2:240507602-240507624 CAGGTCACAGGCAACACACAGGG + Exonic
949017730 2:241722906-241722928 CAGGGCACAGGCACCACTGAAGG - Intronic
949048712 2:241885386-241885408 CAGCCCAGAGGCGCCCCAGGTGG + Intergenic
1171240798 20:23565676-23565698 CAGGAGACTGGGACCCCAGGGGG + Intronic
1172768486 20:37363532-37363554 AAGGCCACAGGGGCCCCAGGAGG - Intronic
1175275796 20:57769924-57769946 CAGGCCACAGGGACTCCAGGGGG - Intergenic
1175650666 20:60719147-60719169 CAGGCCACGGGCACTCCAGCAGG + Intergenic
1175902669 20:62366295-62366317 GAGGGGACATGCACCCCAGGGGG + Intronic
1176036765 20:63043400-63043422 AAGGCCACAGGGACCCCATGCGG + Intergenic
1176153293 20:63604574-63604596 CAGGCCCCAGGTCCCCCAGGTGG - Intronic
1176171762 20:63699398-63699420 CAGGTGAGGGGCTCCCCAGGTGG - Exonic
1176373174 21:6074633-6074655 CAGGTCACCCCTACCCCAGGAGG + Intergenic
1179154751 21:38840200-38840222 CAGGTCAGCGGCACCCCACAGGG - Intergenic
1179163505 21:38917079-38917101 CAGGCCACAGCCTGCCCAGGCGG - Intergenic
1180009374 21:45039904-45039926 AGGGGCACAGGCACCCCTGGGGG - Intergenic
1180702060 22:17786646-17786668 CAGTTCACAGCCACCTCAGGTGG - Intergenic
1180749583 22:18115098-18115120 CAGGGCAGTGGCTCCCCAGGCGG + Intronic
1180841266 22:18959965-18959987 CAGGGCTCAGGCTCCCCAGACGG + Intergenic
1181060230 22:20278829-20278851 CAGGGCTCAGGCTCCCCAGACGG - Intronic
1181434232 22:22900912-22900934 GAGGTCAGGGGCTCCCCAGGTGG + Intergenic
1181435168 22:22906278-22906300 GAGGTCAGGGGCTCCCCAGGTGG + Intergenic
1181436744 22:22915560-22915582 GAGGTCAGGGGCTCCCCAGGTGG + Intergenic
1181438218 22:22922530-22922552 GAGGTCAGGGGCTCCCCAGGTGG + Intergenic
1182583094 22:31327031-31327053 CAGGGCCCAGGTCCCCCAGGGGG + Exonic
1182976545 22:34627694-34627716 CAGATAACAGGCAGCCCAAGAGG - Intergenic
1184231385 22:43160066-43160088 CAGGTGCCAGGCACTCTAGGGGG + Intronic
1184526922 22:45029520-45029542 CAGGTGACATGCACCTGAGGTGG - Intergenic
1184688993 22:46108965-46108987 CAGGGCACAGGCTTCCCAGCAGG + Intronic
1184717342 22:46289577-46289599 CAGGCCCTAGGCACCCCAGCTGG - Intronic
1184909098 22:47514101-47514123 CAGGTGAGAGGCTGCCCAGGGGG - Intergenic
953484729 3:43285261-43285283 CAGGTCAGAGTGATCCCAGGTGG + Intergenic
954810296 3:53243290-53243312 CAGGGCACAGGCCTCCCGGGAGG + Intronic
954840722 3:53509135-53509157 CAGCCCACAGGAACCCCAGCTGG - Intronic
955500737 3:59580200-59580222 CAGGTCAGAGGCACCATTGGGGG - Intergenic
956750754 3:72342154-72342176 CAGGTCCGAGGTACCCCTGGAGG - Intergenic
961466895 3:127087626-127087648 GTGGTCACAGGCACACCAAGAGG - Intergenic
961816481 3:129553321-129553343 CACATTACAGACACCCCAGGGGG - Intergenic
963523088 3:146380724-146380746 AGGGTCACAGGCACCCCACCTGG - Intergenic
967811640 3:193765819-193765841 CAGCTCACTCCCACCCCAGGGGG - Intergenic
967976796 3:195040033-195040055 CAGGTCACTGTCTCCCCACGGGG - Intergenic
968485484 4:859034-859056 GAAGCCACAGGGACCCCAGGGGG + Intronic
968764100 4:2459147-2459169 CAGGGCGCAGGCAGCCCAGGAGG + Exonic
969272819 4:6114381-6114403 GAGGTCACATGGACTCCAGGAGG - Intronic
969511319 4:7619617-7619639 CGGGACACTGGCACCCAAGGAGG - Intronic
969655478 4:8495248-8495270 CAGGTCACTAACACCCCATGGGG - Intergenic
977607361 4:98996031-98996053 GAGGACCCAGGGACCCCAGGAGG - Intronic
979304108 4:119122415-119122437 AAGGTAACAGGCACGCCAGTAGG + Intergenic
981261121 4:142720315-142720337 AAGGTCACAGGACCCCTAGGAGG + Intronic
981440707 4:144778551-144778573 TGGTTCACAGGCATCCCAGGTGG - Intergenic
985445091 4:190017425-190017447 CAGGCTCCAGGCACACCAGGTGG - Intergenic
985792482 5:1937678-1937700 CAGGTGACAGGGACGCCAGATGG - Intergenic
987001953 5:13668700-13668722 GAGGTCACAGTCAACCCTGGAGG + Intergenic
987385380 5:17324058-17324080 CAGGACCCAGGAAGCCCAGGAGG - Intergenic
988822897 5:34905145-34905167 CAGGTTACAAGCACCCCAGGAGG - Intergenic
990372566 5:55135672-55135694 CAGGGCACATGCAGCCCAGGAGG + Intronic
997513275 5:134467144-134467166 CGGGACACTGGCACCCCAGCAGG + Intergenic
997718248 5:136058015-136058037 CAGGCCTGAGGCACCCCTGGGGG + Intronic
997852001 5:137341126-137341148 CAGGCCACAGTCTCCCCAAGGGG + Intronic
999374712 5:151078934-151078956 CAAGTCACAGGCAGCACTGGGGG + Intronic
1001102757 5:168827734-168827756 CAGGACAAGGGCTCCCCAGGCGG + Intronic
1002382871 5:178842766-178842788 CAGGCCTCAGGCACCTGAGGGGG + Intergenic
1003242494 6:4357185-4357207 CACGTAACAGGCTCCCCATGGGG - Intergenic
1004644072 6:17542595-17542617 CAGGTATCAGGCACCCTAGCAGG - Intronic
1005512226 6:26521242-26521264 CAGGTCGCAGTCTCCCCTGGAGG + Intergenic
1006419222 6:33923088-33923110 CATGTCTCTGGGACCCCAGGTGG - Intergenic
1006793548 6:36718386-36718408 CCTGGCCCAGGCACCCCAGGTGG + Intronic
1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG + Intronic
1010644033 6:78365133-78365155 GGGGTCACAGGCACCGCAGCTGG + Intergenic
1011366141 6:86584683-86584705 CAGCTCTCAGGCAGCCCAGAAGG + Intergenic
1011635610 6:89369996-89370018 CAGGCACCAGGCACACCAGGAGG + Intronic
1012581463 6:100875104-100875126 CAGGACACAGGCAAACCAGTTGG + Intronic
1013487619 6:110612485-110612507 CATGGCACAGACATCCCAGGAGG + Exonic
1016983931 6:149880074-149880096 CATGCCACAGGCACCCAGGGTGG - Intergenic
1018099933 6:160428369-160428391 CTGGTCACCTGCAGCCCAGGTGG - Intronic
1019656129 7:2197046-2197068 CAGGTCACAGGAGCCGCAGAAGG - Intronic
1021815933 7:24447704-24447726 CAGGCCTCAGTCACCCCTGGAGG - Intergenic
1024142741 7:46478745-46478767 CTGGTCATAGGCATCTCAGGAGG - Intergenic
1024619316 7:51144112-51144134 CAGCTCACATGCCGCCCAGGTGG - Intronic
1024803773 7:53111734-53111756 CCGGTCTCAGGTAGCCCAGGTGG - Intergenic
1028456256 7:91041074-91041096 CAGGGCAGAGGCACACCTGGAGG + Intronic
1029524944 7:101088626-101088648 CAGGGCCCAGACACCCCACGAGG + Exonic
1029597829 7:101547048-101547070 CAGGCCACACGAAGCCCAGGGGG - Intronic
1032160283 7:129504302-129504324 CAGCCCACAGGCAGCCAAGGGGG - Intronic
1033331512 7:140420718-140420740 CAGGTCACAGACAGCCCAACAGG - Intronic
1035061758 7:156074602-156074624 CAGGCCACACGGAGCCCAGGAGG + Intergenic
1036810690 8:11866386-11866408 CAGGTCCCTTGCTCCCCAGGTGG - Intronic
1039922581 8:41903744-41903766 CTGGTGACAGGCACACCATGGGG - Intergenic
1042733372 8:71961651-71961673 CATGTGACAGGCACCACAGGAGG - Intronic
1043401854 8:79891934-79891956 GAGGCCACAGGCGCCCCGGGAGG - Intergenic
1043401878 8:79891991-79892013 GAGGCCACAGGCGCCCCGGGAGG - Intergenic
1043401890 8:79892020-79892042 GAGGTCACAGGCGCCCCAGGAGG - Intergenic
1045486738 8:102637311-102637333 CAGTGCACAGGCACCCTAGGTGG - Intergenic
1048269575 8:133017848-133017870 CAGGTCCCAGGCCATCCAGGTGG + Exonic
1049208636 8:141375112-141375134 GAGGTCACATACACCCCATGGGG - Intergenic
1049311492 8:141936080-141936102 CAGGGCACAGGAGACCCAGGAGG - Intergenic
1049373185 8:142277367-142277389 CAGGGCACAGGGACCCCTGTGGG + Intronic
1049560869 8:143309653-143309675 CAGGTCCCAGCTACACCAGGCGG - Intronic
1049759144 8:144324051-144324073 CTGCTCACAGGCACCCCAGTCGG - Intronic
1049867223 8:144946873-144946895 CAGGACACAGGCCCCACAGCAGG - Intronic
1049867312 8:144947237-144947259 CAGGACACAGGCCCCACAGCAGG - Intronic
1051448767 9:17171722-17171744 CAGGGCACAGGCACCCCCACCGG + Intronic
1056235282 9:84588105-84588127 CAGGTCACAAGCTCCTCAGTGGG - Intergenic
1056659941 9:88535949-88535971 CAGGGCATCGGCACCCCAAGGGG + Intronic
1057176560 9:93004538-93004560 CAGGCCACAGGGACAGCAGGAGG - Intronic
1059426999 9:114227522-114227544 CTGCTCACAGTAACCCCAGGAGG - Intronic
1059670351 9:116485204-116485226 TGGCTCACAGGGACCCCAGGAGG - Intronic
1061048993 9:128183096-128183118 CCAGTCCAAGGCACCCCAGGAGG + Intronic
1061863988 9:133482696-133482718 CTGGTCTCAAGGACCCCAGGAGG - Intergenic
1061937474 9:133866139-133866161 CTGGTTCCAGGCCCCCCAGGGGG + Intronic
1062044781 9:134419979-134420001 GAGGTCCCAGCCAGCCCAGGAGG + Intronic
1062290430 9:135791945-135791967 GAGGCCACAGGCACCACAGTGGG + Intronic
1062410422 9:136421368-136421390 CAAGTCACAGGCAACCCTGCTGG - Intronic
1062567943 9:137171534-137171556 CAGGTGACAGCCCACCCAGGGGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1186980439 X:14952552-14952574 CAGGTCACAGTCACCCAGGCTGG - Intergenic
1192362135 X:70446733-70446755 CAGGTCCCTGGCACGCAAGGCGG + Intronic
1197520376 X:127490047-127490069 CAGGACTCAGGGACCCCAGGAGG + Intergenic
1197760079 X:130021751-130021773 CAGGTCATAGTCACGTCAGGTGG - Intronic
1199684966 X:150257605-150257627 CCTGTCACATGCACCCCAAGGGG + Intergenic
1201065378 Y:10090817-10090839 CAGGTTCCAGGCACACCAGGTGG + Intergenic