ID: 1007325387

View in Genome Browser
Species Human (GRCh38)
Location 6:41055511-41055533
Sequence ACTCCAGGAGGGAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007325387_1007325399 22 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325399 6:41055556-41055578 TTTCTAGCCTGGTCTCCTATAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1007325387_1007325400 23 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325400 6:41055557-41055579 TTCTAGCCTGGTCTCCTATAGGG 0: 1
1: 0
2: 0
3: 11
4: 82
1007325387_1007325398 11 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325398 6:41055545-41055567 GCAAAGCAGCTTTTCTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007325387 Original CRISPR ACTCCAGGAGGGAGTCCTGG GGG (reversed) Intronic
900211606 1:1459071-1459093 CCTGCAGGAGGGAGGCCTGTGGG + Intronic
900217388 1:1489114-1489136 CCTGCAGGAGGGAGGCCTGTGGG + Intronic
900224414 1:1526371-1526393 CCTGCAGGAGGGAGGCCTGTGGG + Intronic
902268877 1:15288946-15288968 AGTCCAGGAAGGCTTCCTGGGGG + Intronic
902293169 1:15448039-15448061 AATCCAGGATGGCTTCCTGGAGG + Intronic
902779805 1:18697731-18697753 AATCCAGGAGGACTTCCTGGAGG - Intronic
902798910 1:18817509-18817531 AATCCAGGAGGACTTCCTGGAGG + Intergenic
902882943 1:19384842-19384864 ACTCCAGGAGGACTTCCTGAAGG - Intronic
902943068 1:19814454-19814476 TCTGCAGAAGAGAGTCCTGGAGG + Exonic
902948445 1:19861176-19861198 ACTCCAGGAAGGAATTCAGGGGG + Intergenic
903035749 1:20491574-20491596 ACCACAGGAGTGTGTCCTGGGGG + Intergenic
903072027 1:20731435-20731457 ACCCCAGGAGGTAGTGCTGGGGG - Intronic
903188506 1:21642950-21642972 AATCAAGGAGGGCTTCCTGGAGG - Intronic
904260903 1:29287110-29287132 CCCCCAGGAGGGAGTCCCAGGGG + Intronic
904263625 1:29305275-29305297 AGTCAGGGAGGGATTCCTGGAGG - Intronic
904285560 1:29451357-29451379 CCTCCAGGAGGGAGTACGGGTGG + Intergenic
905052079 1:35060526-35060548 CTTCCAGGAGGAATTCCTGGAGG + Intronic
905346115 1:37312209-37312231 AATCCAGGATGGAGGCTTGGAGG - Intergenic
905629642 1:39511427-39511449 AGCCCAGCAGGGAGTCGTGGTGG + Intronic
905668117 1:39774763-39774785 AGCCCAGCAGGGAGTCGTGGTGG - Intronic
906259460 1:44375723-44375745 AGTCAAGGAGGGCTTCCTGGAGG - Intergenic
907210714 1:52819206-52819228 CCTCCAGGTGGGAGTTCAGGTGG - Intronic
907270699 1:53289266-53289288 ACAGCAGCAGGGAGGCCTGGAGG + Intronic
907280834 1:53346187-53346209 ATTCCAGCAGGGCTTCCTGGAGG + Intergenic
907408820 1:54270600-54270622 TTTCCAGGAGGGAGTCTTAGGGG - Intronic
907476539 1:54709740-54709762 AGTCCAGGAAGGCTTCCTGGAGG + Intronic
908667693 1:66510628-66510650 AATCCTGGAGGCAATCCTGGAGG - Intergenic
908938868 1:69409104-69409126 AATCCAGGAGGGAGGCCAAGAGG + Intergenic
912934673 1:113992977-113992999 AATCCAGGAGGGCGGCATGGAGG + Intergenic
914753364 1:150550068-150550090 TCTCCAGCAGGGAGACCTGGGGG + Intronic
915318570 1:155043429-155043451 ACTCCAGCCGGGCCTCCTGGCGG - Exonic
915319102 1:155046452-155046474 ACTGCAGGAAGGAGTGGTGGCGG - Exonic
916298597 1:163248336-163248358 ACTCCATCAGGGTGTCATGGAGG + Intronic
917671317 1:177276108-177276130 ACTCCAGCTGGGATTCCTGCAGG + Intronic
919256235 1:195128527-195128549 ACTCCAGGAGGGACTCTGTGTGG + Intergenic
919919635 1:202160450-202160472 TCTCTAGGAGGGAGTGCGGGAGG - Intronic
922472909 1:225887770-225887792 ACTCCAGGTGGGGGTCGCGGGGG - Exonic
922504890 1:226120765-226120787 ACTCCAGCAGGGAGTCCAGGAGG - Intergenic
923355724 1:233153317-233153339 GTTCCAGGAGGGAGTCAGGGAGG + Intronic
924089573 1:240488278-240488300 ACATCAGGAGGGAGCCATGGTGG - Intergenic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1062768208 10:81056-81078 ACCTCAGGAGGGCTTCCTGGAGG - Intergenic
1065434630 10:25694257-25694279 GCTAGATGAGGGAGTCCTGGGGG + Intergenic
1066032039 10:31438136-31438158 ACGCCAGGAGGGAGGCCTCGTGG - Intronic
1066518984 10:36195149-36195171 ACTTAAAGAGGGAGTCATGGGGG - Intergenic
1068137562 10:52965617-52965639 AGTGCAGAAGGGAGGCCTGGGGG - Intergenic
1069608031 10:69752549-69752571 ATTCCAGGAGAGAGTCAGGGAGG + Intergenic
1069690708 10:70350017-70350039 GCTCAAGGAGGGAGTCCCAGAGG - Intronic
1070413954 10:76171633-76171655 ACCACAGCAGGGATTCCTGGAGG + Intronic
1070619909 10:78001364-78001386 AGTCCAGGTTGGACTCCTGGAGG + Intronic
1070652782 10:78249943-78249965 TTTCGAGGAGGGAGTCCTGCTGG + Intergenic
1070725308 10:78783664-78783686 GCACCAGGAGGGAGCCCTGGAGG - Intergenic
1070746657 10:78937848-78937870 CCTCCTGGCGGGAGCCCTGGAGG - Intergenic
1071970951 10:90906223-90906245 ACTCAAGGATGGCTTCCTGGAGG + Intronic
1073268009 10:102240134-102240156 ACTCCAGCAAGGAGTCTGGGGGG + Intronic
1073732419 10:106305561-106305583 AATCCTGGATGGAGTCTTGGGGG + Intergenic
1074126758 10:110534752-110534774 AATCCAGGAGGCCTTCCTGGAGG + Intergenic
1074770978 10:116733586-116733608 ACTCCAGGAGTAAGTTCTGTAGG - Intronic
1075077167 10:119359210-119359232 AATCCAGGAAGGCTTCCTGGAGG + Intronic
1075855608 10:125626888-125626910 CCTCCAGGAGGTCGTGCTGGAGG - Intronic
1076314002 10:129527996-129528018 AGTCCAGGAAGGCTTCCTGGAGG - Intronic
1076852292 10:133099113-133099135 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1076852329 10:133099221-133099243 CCTCCAGGAGAAAGTGCTGGGGG + Intronic
1077412844 11:2411424-2411446 ACTCCAGGCGGCCGTCATGGGGG + Exonic
1078549071 11:12268147-12268169 GGTTCAGGAGGGAGACCTGGAGG + Intergenic
1078743952 11:14093278-14093300 ACCACATGAGGGTGTCCTGGAGG + Intronic
1079216638 11:18519088-18519110 AGTCCAGGAGGCAGTCCAGGAGG - Intronic
1081759567 11:45567837-45567859 AATCCTGGAGGGCATCCTGGAGG - Intergenic
1081790030 11:45776015-45776037 AGTCCAGAAGGGCTTCCTGGAGG - Intergenic
1082160004 11:48880335-48880357 ACTGGAGGAGGGCGTCCTAGAGG + Intergenic
1082162771 11:48901935-48901957 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1082243495 11:49893513-49893535 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1082243500 11:49893528-49893550 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1082657291 11:55870262-55870284 ACTTCACGGGGGGGTCCTGGTGG - Intergenic
1082657987 11:55874339-55874361 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1083068348 11:59949203-59949225 ACTCCATGAGGGATTCTTTGTGG - Intergenic
1083539609 11:63503419-63503441 ACTCAAAGAGGGAGTCGGGGTGG - Intergenic
1083675463 11:64322606-64322628 ATTCCAGGAGGGCTCCCTGGGGG + Intergenic
1084579053 11:70011085-70011107 AGTACAGGAGGGCCTCCTGGAGG + Intergenic
1084783134 11:71424496-71424518 ACTCCAGCAGGGTGTGGTGGCGG - Intergenic
1085034496 11:73291977-73291999 ATTCCAAGAGGGCGACCTGGAGG - Intronic
1085126101 11:74003789-74003811 TCTCTGGGAGGGAGTGCTGGAGG + Intronic
1085386034 11:76158857-76158879 ACTCAAGGAGGGAGTGCTAAGGG + Intergenic
1085479662 11:76810692-76810714 ACACCAGGAAGGAGGCCAGGAGG + Intergenic
1085750442 11:79156386-79156408 ACCCCACCAGGGAGTCTTGGAGG + Intronic
1086605614 11:88692835-88692857 CCTCCAGGATGGAGGCATGGAGG - Intronic
1086690596 11:89786171-89786193 ACCGGAGGAGGGCGTCCTGGAGG + Intergenic
1086697920 11:89865336-89865358 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1086697925 11:89865351-89865373 CCTGGAGGAGGGCGTCCTGGAGG - Intergenic
1086708237 11:89979137-89979159 CCTGGAGGAGGGCGTCCTGGAGG + Intergenic
1086708242 11:89979152-89979174 CCTGGAGGAGGGCGTCCTGGAGG + Intergenic
1086715203 11:90053489-90053511 ACCGGAGGAGGGCGTCCTGGAGG - Intergenic
1089381456 11:118035664-118035686 TCTCCAGGAGGGAATCCTCCTGG - Intergenic
1089634221 11:119802035-119802057 AGTTCAGGAGGGCTTCCTGGAGG + Intergenic
1089645550 11:119876356-119876378 ACTCCAGGAGAGAAGCCTGTGGG - Intergenic
1089690422 11:120183700-120183722 AATCCAGGAGGGCCTCTTGGAGG - Intronic
1090406846 11:126481223-126481245 AAGCCAGGAGGGAATCCCGGAGG - Intronic
1091121194 11:133059060-133059082 AATCCACAAGGTAGTCCTGGAGG - Intronic
1092070771 12:5629636-5629658 ACTCCAGGAGGGGATACAGGTGG - Intronic
1096263548 12:50107174-50107196 GCTCCAGGAGGTGGTCCAGGGGG + Intronic
1098671468 12:73235551-73235573 AGTGCAGGAGGGAGGCCTGTGGG - Intergenic
1099391061 12:82078760-82078782 AGTCCAGGAGGGAAGCATGGAGG - Intergenic
1102041671 12:109805010-109805032 AATCCAGGAGAGCTTCCTGGAGG - Intronic
1102042768 12:109811144-109811166 AATCCAGGAGGGCTTCTTGGAGG - Intronic
1102392875 12:112563640-112563662 AATCCAGCAAGGAGTCTTGGGGG - Intergenic
1102461575 12:113103010-113103032 ACTCAAGGAGGGCTTCCTGGAGG - Intronic
1103821522 12:123702510-123702532 ACTTGGGGAGGGAGTCCTGTTGG + Intronic
1104140475 12:125982850-125982872 ACACCAGGAGAGGCTCCTGGTGG + Intergenic
1104996601 12:132661742-132661764 ACTCCTGGAGGGACACCAGGTGG - Intronic
1105707597 13:22977776-22977798 ATTCCAGGAGGGACTGCTGTTGG - Intergenic
1105826271 13:24126186-24126208 TCTCCAGGATGAAGTCATGGGGG + Intronic
1106467124 13:30023351-30023373 GCTCCAGGAAGGAGTCCTCTGGG - Intergenic
1107012408 13:35681664-35681686 ACTAAAGGAGAGAGTCCTAGAGG + Intergenic
1107423313 13:40269679-40269701 AGCCCAGGAGGGTGGCCTGGTGG - Intergenic
1108438054 13:50420772-50420794 ACTCCTGGATGGAGACCAGGTGG + Intronic
1112488662 13:99842478-99842500 GCACCAGGAGAGAGTCCTAGAGG - Intronic
1112501542 13:99946927-99946949 AGCCCAGCAGAGAGTCCTGGAGG - Intergenic
1113415405 13:110124935-110124957 ACTCCAGGAAGGAGCTCTGCGGG + Intergenic
1113794810 13:113050808-113050830 ACTCCAGGAGGACTTCCCGGCGG + Intronic
1114627976 14:24141626-24141648 ACTCCAGGAGCCAGTTCTGCAGG - Intergenic
1118571497 14:67199793-67199815 GCTCCAGGAGGCAGCACTGGGGG - Intronic
1118752208 14:68815768-68815790 AATCCAGGAAGGCTTCCTGGTGG + Intergenic
1119416182 14:74471167-74471189 ACTCCAGGATGGAATCGTGAGGG - Intergenic
1119481755 14:74962349-74962371 ACTCCACTGGGGAGGCCTGGGGG + Intergenic
1120681747 14:87488306-87488328 TCTCCAGTGGGGAGCCCTGGAGG - Intergenic
1122343267 14:101042652-101042674 TCACCAGGAGGGCTTCCTGGAGG + Intergenic
1122343615 14:101044702-101044724 GCCCCAGGAGGGCTTCCTGGAGG + Intergenic
1122366462 14:101197610-101197632 GCTCCAGGAGGGCTTCCTGGAGG + Intergenic
1122546332 14:102524697-102524719 ACTCCTGCAGGGACTCCTGGCGG - Intergenic
1122976596 14:105173400-105173422 ACACCAGGTGGGAATCCGGGTGG - Intronic
1123123229 14:105927663-105927685 ATTCCTAGAGGGAGCCCTGGTGG - Intronic
1123405882 15:20019163-20019185 ATTCCTAGAGGGAGCCCTGGTGG - Intergenic
1123515212 15:21025811-21025833 ATTCCTAGAGGGAGCCCTGGTGG - Intergenic
1123979659 15:25589209-25589231 AATCCAAGAGGGAGCCCAGGTGG - Intergenic
1124197417 15:27644663-27644685 ACCTCAGCAGGGAGACCTGGTGG + Intergenic
1124345162 15:28917351-28917373 ACCCTAGGAAGGAGCCCTGGAGG - Intronic
1128155576 15:65389628-65389650 AATCCAGGAAGGTTTCCTGGAGG - Intronic
1128868813 15:71136767-71136789 CCTCCAGGAGGGGGTCCTCCAGG + Intronic
1129170595 15:73805245-73805267 AATCCAGGAGGGCTTCCTAGAGG + Intergenic
1129254751 15:74327781-74327803 GCTCATGGAGTGAGTCCTGGGGG - Intronic
1129766161 15:78169883-78169905 ACTACAGCAGGTAGTTCTGGGGG + Exonic
1130133178 15:81160574-81160596 ATTCTAGGGTGGAGTCCTGGGGG - Intronic
1130163022 15:81421058-81421080 TCCCCAGGGGAGAGTCCTGGTGG - Intergenic
1130352772 15:83106803-83106825 ATTCCAGGAAGCATTCCTGGAGG - Intergenic
1130834944 15:87640854-87640876 GCTCCTGGAGGGGATCCTGGAGG - Intergenic
1131052767 15:89359333-89359355 ATTCCAGGAGAGAGCCGTGGAGG - Intergenic
1132342020 15:101084982-101085004 GCTCCAGGAGGGGGTTTTGGAGG - Intergenic
1132384416 15:101390091-101390113 TCTTCAGGAGGACGTCCTGGTGG - Intronic
1132457108 16:30032-30054 ACCTCAGGAGGGCTTCCTGGAGG - Intergenic
1132688392 16:1171710-1171732 ACTCCAGGAGGGAGGGAGGGTGG - Intronic
1132935099 16:2475833-2475855 CCTCCAGGCGGGAGTCCCCGCGG + Intronic
1133201650 16:4207601-4207623 ACTCCCCGAGGAAGTCCAGGAGG - Intronic
1133905791 16:10021304-10021326 CATCCAGGAGGGATTCCAGGAGG - Intronic
1134833056 16:17338897-17338919 ACTCCTGGAAGGCTTCCTGGAGG - Intronic
1135322535 16:21506958-21506980 ACTCCTGGAGGCAGTCCCCGGGG - Intergenic
1135901363 16:26463000-26463022 AATCCAGGAGAGCTTCCTGGAGG - Intergenic
1136334014 16:29600096-29600118 ACTCCTGGAGGCAGTCCCCGGGG - Intergenic
1136615238 16:31394411-31394433 ACCCCAGGGAGGTGTCCTGGAGG + Intronic
1138080963 16:54091097-54091119 AATGCAGGAGTGAGTGCTGGAGG + Intronic
1138514740 16:57529734-57529756 GCTCCAGGAGGGCTTCCAGGAGG - Intronic
1141117594 16:81323805-81323827 ACAAGAGGATGGAGTCCTGGAGG - Intronic
1141435694 16:83998555-83998577 ACCCCAGCAAGGAGTCCTGGGGG - Intronic
1141631475 16:85290314-85290336 ACTCCAGGTTGGGGGCCTGGGGG - Intergenic
1141684813 16:85564173-85564195 AATCCAGGAAGGCTTCCTGGAGG + Intergenic
1141901562 16:86994443-86994465 ACTCCAAGAAGGCTTCCTGGAGG + Intergenic
1141996517 16:87639616-87639638 AGGCCAGGAGGGAGGCCAGGAGG - Intronic
1142005220 16:87686554-87686576 ACTCCAGGACTGAGCCCTCGAGG - Intronic
1142034776 16:87856186-87856208 ACTCCTGGAGGCAGTCCTCGGGG - Intronic
1142122951 16:88396334-88396356 CCTCCTGCAGGGAGGCCTGGAGG + Intergenic
1142343372 16:89538305-89538327 ACTCCATGTGGAAGTCCTGTTGG + Intronic
1142890940 17:2942189-2942211 ACTCGGGGAGGGAGGCCTGGAGG - Intronic
1143001780 17:3799193-3799215 AGTCCAGGAGAGTTTCCTGGAGG - Intronic
1143411290 17:6711018-6711040 AGGCCAGGAGGGAATCCAGGTGG + Intronic
1144580404 17:16455965-16455987 TCTGCAGGAGGGAGCCCTGGAGG - Intronic
1144654936 17:17029378-17029400 GCTCCAGGAAAGCGTCCTGGTGG + Intergenic
1144800496 17:17922889-17922911 ACTCCAGGAGGCAGTTAAGGTGG - Intronic
1144945168 17:18966057-18966079 AAGTCAGCAGGGAGTCCTGGAGG + Intronic
1145060776 17:19731875-19731897 CCTCCAGCAGGCAGTCGTGGCGG - Intergenic
1146065558 17:29632157-29632179 ACAGCAGGAAGGAGTCCTGAAGG - Exonic
1146555138 17:33816720-33816742 TCTGCAGGAGGGAGGGCTGGAGG - Intronic
1147686725 17:42290351-42290373 ACCCCAAGAGGGAGGTCTGGTGG - Intronic
1148155556 17:45423497-45423519 AATCCAGGAGTGCTTCCTGGAGG - Intronic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148506154 17:48128708-48128730 ACTCCTGGTGGGAGACCTGCGGG + Intergenic
1148718170 17:49730614-49730636 AGTCAAGGAGGGCTTCCTGGAGG - Intronic
1148886131 17:50774319-50774341 ATTCCTTGAGGGAATCCTGGAGG + Intergenic
1149364888 17:55933471-55933493 AATCCAGGAGTGATACCTGGAGG + Intergenic
1149640030 17:58196815-58196837 AGTCAAGGAGGGCTTCCTGGAGG + Intronic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1150331302 17:64296614-64296636 ACCCCAGGAGGGAGGCCGAGGGG - Intergenic
1151183931 17:72349860-72349882 TCTCCAGGAGGGAGGCCCAGGGG + Intergenic
1151570614 17:74923683-74923705 ACTCCAGCAGGGGGCGCTGGAGG + Intergenic
1152071926 17:78138342-78138364 TCTTCAGGAGGGTGTACTGGGGG - Exonic
1152405418 17:80095510-80095532 ACTCCAGGAAGGCGTCTTGCTGG + Intronic
1152961097 18:80553-80575 ACCTCAGGAGGGCTTCCTGGAGG - Intergenic
1153509702 18:5838445-5838467 ACCCGAGGAGGGAGTCATGGGGG + Intergenic
1154383806 18:13875632-13875654 CCACCAGGACGGAGTCCAGGAGG + Intergenic
1156127884 18:33929388-33929410 AATCCAGGAGGGCTTCCTAGAGG - Intronic
1158649760 18:59274214-59274236 ACTCCAGGTGGGTCTCCTGCGGG - Intergenic
1158973787 18:62692400-62692422 TCTCCAGGAGGCAGCCCTGCAGG + Intergenic
1160304439 18:77718559-77718581 ACCCCAGGAGTGAGGCCAGGGGG - Intergenic
1160442721 18:78904479-78904501 GCTCCAGGAGTGAGGACTGGGGG + Intergenic
1160589455 18:79935017-79935039 AATCCAAGAGGCAGTGCTGGGGG - Intronic
1160851538 19:1195252-1195274 AGGCCAGGAGGGAGGACTGGCGG + Intronic
1160851962 19:1197066-1197088 AGGCCAGGAGGGAGGACTGGCGG + Intronic
1160937969 19:1606271-1606293 AGTCCAGGAGGGCTTCCTGAGGG - Intergenic
1161103055 19:2430753-2430775 CCGCCAGGAGGGAGGGCTGGGGG + Exonic
1161258738 19:3323828-3323850 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1161341484 19:3745548-3745570 GATCCAGGAGGGCTTCCTGGAGG + Intronic
1161348302 19:3778658-3778680 AACCCAGGAGGGCTTCCTGGAGG - Intronic
1161471766 19:4460844-4460866 AGTCCAGGAGAGCGTCATGGTGG - Intergenic
1161495959 19:4585713-4585735 GATCCAGGAGGGCTTCCTGGAGG + Intergenic
1162067233 19:8133189-8133211 ACTCCAGGGAGGGATCCTGGGGG - Intronic
1162232684 19:9280889-9280911 ATTCAGGGAAGGAGTCCTGGAGG + Intergenic
1162845510 19:13389313-13389335 TCTCCAGGAGGGACACCAGGTGG + Intronic
1162907276 19:13831365-13831387 GCTCCAGGAGGGAGGCTGGGAGG + Exonic
1163428875 19:17254835-17254857 ACTCCAGGAGGGCTTCCTTGAGG + Intronic
1163775030 19:19212660-19212682 ACTCAGGGAGGAGGTCCTGGGGG + Intronic
1164565169 19:29320808-29320830 ACTCCAGGTGCAAGTGCTGGGGG + Intergenic
1165728485 19:38129228-38129250 AGTGAAGCAGGGAGTCCTGGAGG + Intronic
1166076384 19:40415978-40416000 AATCAAGGAGGGCTTCCTGGAGG + Intergenic
1166167805 19:41004438-41004460 AATCCAAGGGTGAGTCCTGGGGG + Exonic
1166214009 19:41324045-41324067 ACTCCAGGAGGCAGTTTTGAGGG - Exonic
1166668817 19:44697827-44697849 AGTCCAGGAGGGCTTCCTGGAGG + Intergenic
1166876389 19:45900426-45900448 GGTCCAGGAGGGCTTCCTGGAGG - Intronic
1166994515 19:46713878-46713900 CATCCAGGAGGGCGACCTGGTGG - Exonic
1167095693 19:47373879-47373901 AATCCAGGAGGGCTTCCTGGAGG + Intronic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1168252761 19:55149738-55149760 TCACCAGGATGGAATCCTGGCGG - Intergenic
1168319075 19:55498223-55498245 ACTCCAGGAGGGCTTCCTGGAGG + Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925076207 2:1018425-1018447 ACTAAAGCAGGGATTCCTGGAGG - Intronic
925150828 2:1613656-1613678 CTTCCAGGAGGGAGTCCTCAAGG - Intergenic
925608372 2:5682538-5682560 AGCCCAGGAGAGAGGCCTGGTGG - Intergenic
926181774 2:10651124-10651146 TCTCCAGGAGGCAGGGCTGGAGG - Intronic
927068920 2:19504826-19504848 ACCCCAAGAGTGAGTCCTGGAGG + Intergenic
927518007 2:23683137-23683159 GGGCCAGGAAGGAGTCCTGGCGG + Intronic
927700195 2:25263264-25263286 ACTCCAGGAAAGCTTCCTGGAGG - Intronic
927818890 2:26244956-26244978 GCTCCGAGAGGGAGTCCTCGCGG + Exonic
928086107 2:28347415-28347437 AATCCTGGAGGGCTTCCTGGAGG + Intergenic
932319709 2:70812726-70812748 GCTCCAGGAGAAAGGCCTGGGGG + Intronic
934994961 2:98949479-98949501 GCCCCAAGAGGGAGTCCTTGGGG + Intergenic
936093500 2:109515439-109515461 ACTCCAGGACAAAGCCCTGGTGG + Intergenic
936998085 2:118436011-118436033 ACTGAAGGAGGCAGTCATGGTGG + Intergenic
937224484 2:120360348-120360370 TCACCAGGAGGGCTTCCTGGGGG + Intergenic
937249416 2:120514172-120514194 AATCCAAGAGGGCTTCCTGGAGG - Intergenic
937332612 2:121041726-121041748 AGTCAAGGAGGGCTTCCTGGAGG - Intergenic
938552831 2:132396417-132396439 ACTCCACCATGGAGTCTTGGTGG - Intergenic
940883773 2:158970667-158970689 ACCCTAGGAGGAAGTCCTGAAGG - Intronic
943699535 2:190974720-190974742 TCTGCGGGAGGGAGCCCTGGCGG - Intronic
943985056 2:194607409-194607431 ACTTCAGGGTGGAGTCCTTGGGG - Intergenic
946486158 2:220102845-220102867 ATTCCTGGAGGGCTTCCTGGTGG - Intergenic
947436787 2:230079632-230079654 ACTCAAGGAGAAAGTCCGGGTGG + Intergenic
947630389 2:231648852-231648874 ATGCCAGGAGGGAGGGCTGGTGG + Intergenic
947708565 2:232295762-232295784 ACTCTTGCAGGGAGTGCTGGGGG - Intronic
947828988 2:233125598-233125620 CCTCCAGGAGGGAGTCAGCGAGG + Intronic
948374445 2:237512188-237512210 TCTCCAGAAGGAAGGCCTGGGGG - Intronic
948981528 2:241497153-241497175 GCTCCAGGTGGGGCTCCTGGAGG + Intronic
949008051 2:241661410-241661432 GCCCCAGGAGGGAGTAGTGGGGG + Intronic
1169012409 20:2261409-2261431 ACTCCAGGAAGGCTTCCTGGGGG + Intergenic
1169067799 20:2704278-2704300 ATTCCTGGAGGGTGTCCTAGGGG + Intronic
1169490221 20:6065028-6065050 ACTCCAGTCGATAGTCCTGGTGG - Intergenic
1169558098 20:6770002-6770024 AAGCCAGGAGGGCATCCTGGAGG + Intronic
1169724638 20:8715678-8715700 ACTTGGGGAGGGGGTCCTGGAGG - Intronic
1170789826 20:19498472-19498494 ACTGCAGGAGGCAGTCCAGGTGG - Intronic
1170943201 20:20866307-20866329 ACACTTGGAGGGAGGCCTGGAGG - Intergenic
1171427571 20:25058217-25058239 GCTCCGGGAGGGGGCCCTGGAGG - Intronic
1172195980 20:33091892-33091914 AGTCAAGGAGGGCTTCCTGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1175404117 20:58716078-58716100 ACTCCAGGTGGAAGTGCTGTGGG + Intronic
1175843851 20:62048669-62048691 ACGCCAGGAGAGGGCCCTGGGGG - Intronic
1175895999 20:62335820-62335842 AGTCCATGAGGGTGTCCTGGAGG - Intronic
1178898653 21:36581791-36581813 CCTGCAGTAGTGAGTCCTGGGGG - Intergenic
1179715148 21:43282514-43282536 GGTCCAGGAGGGGGTCCAGGAGG + Intergenic
1180684559 22:17655249-17655271 CCTCCAGGAGGGATTCCAGAAGG - Intronic
1180954213 22:19734271-19734293 CCTCCAGGAGGGTAGCCTGGGGG + Intergenic
1181037603 22:20177461-20177483 ACTCGCTGAGGGGGTCCTGGAGG - Intergenic
1181514101 22:23401746-23401768 GCTCCTGGAGGCAGGCCTGGGGG + Intergenic
1182099088 22:27645370-27645392 AGTCCAGGAAGGCTTCCTGGTGG - Intergenic
1183377666 22:37474430-37474452 ACGCCAGGAGGGAGGGTTGGGGG + Intronic
1184257329 22:43294697-43294719 ATTCCAGGAGGACTTCCTGGAGG - Intronic
1184884225 22:47332413-47332435 GCTCAAGGAGGGGCTCCTGGAGG + Intergenic
1185070886 22:48655026-48655048 AATCCAGGAAGGCTTCCTGGAGG + Intronic
1185317206 22:50184366-50184388 TCCCCAGCACGGAGTCCTGGTGG + Intergenic
1185399313 22:50607773-50607795 AGTTTAGGAGGGAGACCTGGAGG + Intronic
949935707 3:9113940-9113962 ACTCCTCGGGGGACTCCTGGTGG - Intronic
950303485 3:11901194-11901216 GCTCCAGGGGGGAGTCCTCCAGG - Intergenic
950506392 3:13397384-13397406 GCTCCAGGGGGGAGTCCTCCAGG + Exonic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
950638582 3:14333349-14333371 AGACCAGGAGGGCTTCCTGGAGG - Intergenic
951242223 3:20300854-20300876 ACTCCAGGAGTAACTCCTAGAGG - Intergenic
952128574 3:30332737-30332759 ACTCCAGGACAGACTCCTGTAGG - Intergenic
952866187 3:37856664-37856686 ACCCCAGGAGAGAGACCTGTGGG + Intergenic
953716301 3:45319490-45319512 ATTCCAGGAGGGATTTGTGGAGG + Intergenic
954035239 3:47847720-47847742 ATTCCAGGGGGGAATTCTGGTGG + Intronic
956425349 3:69128690-69128712 GGTCCAGGAGGGCTTCCTGGAGG - Intergenic
957711062 3:83860050-83860072 ACACCACGAGGAAGTCTTGGTGG + Intergenic
958539301 3:95449722-95449744 ATCCTAGGAAGGAGTCCTGGAGG - Intergenic
960149436 3:114235923-114235945 TTTCCAGGAGGGAGACCTGTTGG - Exonic
961319844 3:126064850-126064872 ATTCCAGTGAGGAGTCCTGGTGG + Intronic
962872113 3:139506419-139506441 ACTCAAGGAGGGCTTCTTGGAGG + Intergenic
964272134 3:154968066-154968088 AGCCGAGGAGGGAGTCCTGAGGG - Intergenic
966038995 3:175457347-175457369 ACTTCAATAGGGAGACCTGGCGG - Intronic
968540443 4:1165558-1165580 GCTCCAGGAGGGAGGGCAGGTGG + Intergenic
969176496 4:5402852-5402874 AGTGCAGGAGGGCTTCCTGGAGG + Intronic
969453743 4:7289314-7289336 AATCCAGGAAGGCTTCCTGGAGG - Intronic
971434569 4:26606473-26606495 ACCCCAGGATGGAGTGGTGGAGG + Intronic
971996596 4:33973413-33973435 ACTTCATCAGGGAGTTCTGGTGG + Intergenic
972999530 4:44928573-44928595 GCTACGGAAGGGAGTCCTGGTGG - Intergenic
974868344 4:67607237-67607259 ACTCAAGGAGAGAGGCCTCGGGG + Intronic
976523237 4:86054856-86054878 ACTCAAAGAGGTAGTCCTTGTGG + Intronic
976554402 4:86433327-86433349 GCTCCAGCTGGGGGTCCTGGAGG - Intronic
976729061 4:88244399-88244421 AGTACGGGAGGGAGGCCTGGGGG + Intergenic
978176677 4:105740281-105740303 ACTCCAGTAGTGAGTCCTACTGG - Intronic
980503231 4:133683543-133683565 AGGCCAAGAAGGAGTCCTGGTGG - Intergenic
981283402 4:142987221-142987243 CCTTGAGGAGGGAGTTCTGGAGG - Intergenic
982068590 4:151675460-151675482 ACTCCTGGCTGGAGTCCAGGAGG + Intronic
984424823 4:179569999-179570021 ACTCCAGGATTGATTACTGGGGG + Intergenic
984807660 4:183766443-183766465 ACAGCTCGAGGGAGTCCTGGAGG + Intergenic
985136080 4:186787422-186787444 ACTCCAAGAGGAAGACTTGGGGG + Intergenic
988691409 5:33576396-33576418 ATCTCAGCAGGGAGTCCTGGTGG - Exonic
993414492 5:87609625-87609647 ACTCCAAGAGGGAGGCCTCATGG - Intergenic
997247039 5:132358482-132358504 ACTGCAGGAGGGTGAGCTGGAGG - Intergenic
997436632 5:133880394-133880416 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
998808452 5:145941464-145941486 CCTCCAGGAAGAGGTCCTGGTGG + Intronic
999144982 5:149386465-149386487 GCTCCTGCAGGGAGTCCAGGGGG - Intronic
999614396 5:153406695-153406717 ACTCCAAGAAGCAGTCCTGGTGG - Intergenic
1002098633 5:176846529-176846551 CATCCAGGAGGGCTTCCTGGAGG - Intronic
1002803692 6:551618-551640 ACACCAGGAGGGAGTGCCTGAGG + Intronic
1003227977 6:4223586-4223608 GCTCCAGGAGGGACTCCATGTGG - Intergenic
1003259358 6:4502852-4502874 ACTCCAGGTAGGATTCCAGGTGG - Intergenic
1004024466 6:11805482-11805504 GATCCAGCAGGGAGTCATGGAGG - Intronic
1005829152 6:29656896-29656918 TCTCCAGGAGGGAGTGGGGGAGG + Intergenic
1006344620 6:33470805-33470827 ACTCCAGCATGCAGGCCTGGAGG - Intergenic
1007102571 6:39259882-39259904 AGTCCAGGAAGGCTTCCTGGAGG - Intergenic
1007249901 6:40488454-40488476 CCTGCAGGAGGGAGGCTTGGAGG - Intronic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1007736508 6:43985379-43985401 CCTTCATGAGAGAGTCCTGGAGG - Intergenic
1012388700 6:98711333-98711355 TCTCCAGGAGGGATTCCTTTAGG + Intergenic
1012543750 6:100393587-100393609 AGGCCGGGAGGGAGCCCTGGTGG - Exonic
1013466986 6:110426498-110426520 CCTCCTGGAGGGAGGCCAGGCGG + Intronic
1014432626 6:121388681-121388703 GGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1014706064 6:124749158-124749180 ACTCAAGCAGAGAGACCTGGTGG - Intronic
1022528022 7:31050915-31050937 AGTCCAGGAGAGCTTCCTGGTGG - Intergenic
1024582293 7:50809855-50809877 CCTCCAGGAGGGACACCTGCAGG + Intergenic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1026865822 7:73823392-73823414 ACACCAGGCAGGATTCCTGGAGG - Intronic
1026897604 7:74019334-74019356 AGTCCAGGAGGGCTTCCTGGAGG - Intergenic
1028751686 7:94390379-94390401 AATCAAGGAGGGCTTCCTGGAGG - Intergenic
1029514893 7:101018262-101018284 AGGAGAGGAGGGAGTCCTGGGGG - Intronic
1029594914 7:101532586-101532608 AATCAAGGAGGACGTCCTGGAGG - Intronic
1029608817 7:101615659-101615681 ACTCCAGGAGAGCTTCCTAGTGG - Intronic
1030344068 7:108413538-108413560 AATCAAGGAGGGCTTCCTGGAGG - Intronic
1030614907 7:111728996-111729018 AGCCCAGGAGGGAGGCCTCGGGG + Intronic
1030619020 7:111769491-111769513 ACCCCAGGAGGGACCCCGGGCGG + Intronic
1032066935 7:128778902-128778924 GCCGCAGGTGGGAGTCCTGGTGG + Intergenic
1032189573 7:129756417-129756439 GCTTCAGAAGGGACTCCTGGAGG + Exonic
1032979884 7:137269333-137269355 GCCCCAGAAGGGAGTCCTGGAGG + Intronic
1034452640 7:151145427-151145449 AGTCCAGAAGGAAGACCTGGGGG + Intergenic
1034545560 7:151786496-151786518 GCTCCTGGACGGAGACCTGGAGG - Exonic
1035064390 7:156094686-156094708 ATGGCAGGAGGGAGGCCTGGTGG - Intergenic
1035557239 8:576508-576530 GCTCCAGGAGCGAGTCCAGGAGG + Intergenic
1037097204 8:15000175-15000197 AGTCAAGGAGAGAGTCCTGTAGG + Intronic
1038101311 8:24379932-24379954 CATCCAGTAGGGATTCCTGGTGG + Intergenic
1040579779 8:48688358-48688380 GCAGCAGGAGGGTGTCCTGGCGG - Intergenic
1041543013 8:59008587-59008609 ACTCATGGGGGGAGTCATGGGGG - Intronic
1041720883 8:60974248-60974270 CCTCCGGGAGGGACTCGTGGAGG - Intergenic
1043547843 8:81335321-81335343 TTTCCAGGAAGGAGTCCTGACGG + Intergenic
1048385902 8:133912346-133912368 AGTCCAGGAAGGCTTCCTGGGGG + Intergenic
1049207825 8:141371592-141371614 AATCCGGGAGGGATTGCTGGTGG + Intergenic
1049339247 8:142103133-142103155 AGTCAAGGAGGGCTTCCTGGAGG + Intergenic
1049426495 8:142540244-142540266 GCCCCAGGAGGGCTTCCTGGAGG + Intronic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1050628535 9:7534411-7534433 ACTCCTGGAGGGGGTGGTGGTGG + Intergenic
1053429684 9:38033861-38033883 AATCCAGGAGGTGGTGCTGGGGG - Intronic
1055979717 9:81990076-81990098 TATCCAGGAGGGACTGCTGGTGG + Intronic
1056495886 9:87154826-87154848 ATTCCAGGAGAGCTTCCTGGAGG + Intronic
1059313072 9:113401493-113401515 ACTGCAGGAGGGAGGCCACGAGG + Intergenic
1059426494 9:114224224-114224246 GCTCCAGAAGGGATTCCTGTTGG - Intronic
1060219180 9:121755367-121755389 GCCCCAGGTGGGAGTCCTTGTGG + Intronic
1060845900 9:126837422-126837444 TCTCAAGGAGGGAGCCCTGGAGG - Exonic
1060895495 9:127214587-127214609 ACCACTGGAGGGAGCCCTGGAGG + Intronic
1061042909 9:128150042-128150064 AGTCCAGAAGGGAGTCCTGGGGG - Intronic
1061314689 9:129787590-129787612 CGACCAGGTGGGAGTCCTGGTGG + Intergenic
1061621715 9:131814891-131814913 AATCCAGGAAGGCTTCCTGGAGG - Intergenic
1061646190 9:132004030-132004052 AAGCTAGGAGGAAGTCCTGGTGG - Intronic
1061937679 9:133867254-133867276 CTTCCTGGAGGGAGGCCTGGTGG - Intronic
1061949185 9:133926686-133926708 AGTCAAGGAGGGCTTCCTGGAGG - Intronic
1062027158 9:134345918-134345940 AATCAAGGAGGGCTTCCTGGAGG - Intronic
1062272995 9:135718303-135718325 AATGCAGGAGGGAGTGCAGGCGG + Intronic
1062461822 9:136665565-136665587 ATTCCCGGAGGGGGTGCTGGCGG + Intronic
1062730026 9:138103526-138103548 CACCCAGGAGGGAGGCCTGGAGG - Intronic
1062737064 9:138143433-138143455 ACCTCAGGAGGGCTTCCTGGAGG + Intergenic
1187516212 X:19973651-19973673 AGTCCAGGAAAGAGTCCTAGGGG - Intergenic
1187527375 X:20066343-20066365 TGTCCAGGAGGGAGGCCTGAAGG + Intronic
1191051366 X:56196047-56196069 ACTCTTGAAGGCAGTCCTGGTGG - Intergenic
1192011411 X:67277466-67277488 ACACCAGGAGGGATGGCTGGAGG - Intergenic
1192529444 X:71872484-71872506 ACTACTGGAGCGAGTCCGGGGGG + Intergenic
1199293502 X:146131411-146131433 AGAACAGGAGGGAGACCTGGAGG - Intergenic
1200399251 X:156009694-156009716 ACCTCAGGAGGGCTTCCTGGAGG + Intronic
1201061665 Y:10051791-10051813 CCTGGGGGAGGGAGTCCTGGAGG + Intergenic