ID: 1007325387

View in Genome Browser
Species Human (GRCh38)
Location 6:41055511-41055533
Sequence ACTCCAGGAGGGAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007325387_1007325399 22 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325399 6:41055556-41055578 TTTCTAGCCTGGTCTCCTATAGG 0: 1
1: 0
2: 0
3: 5
4: 101
1007325387_1007325398 11 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325398 6:41055545-41055567 GCAAAGCAGCTTTTCTAGCCTGG No data
1007325387_1007325400 23 Left 1007325387 6:41055511-41055533 CCCCCAGGACTCCCTCCTGGAGT 0: 1
1: 0
2: 3
3: 31
4: 368
Right 1007325400 6:41055557-41055579 TTCTAGCCTGGTCTCCTATAGGG 0: 1
1: 0
2: 0
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007325387 Original CRISPR ACTCCAGGAGGGAGTCCTGG GGG (reversed) Intronic