ID: 1007325556

View in Genome Browser
Species Human (GRCh38)
Location 6:41056873-41056895
Sequence TTACCTAAATCTAGTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007325556_1007325560 6 Left 1007325556 6:41056873-41056895 CCAGCAACACTAGATTTAGGTAA 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1007325560 6:41056902-41056924 CCCTGGCTCATGCCTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007325556 Original CRISPR TTACCTAAATCTAGTGTTGC TGG (reversed) Intronic