ID: 1007326006 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:41060123-41060145 |
| Sequence | AAGGAGAAGAAAAAAGAGAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 7265 | |||
| Summary | {0: 2, 1: 6, 2: 118, 3: 963, 4: 6176} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1007326006_1007326009 | 6 | Left | 1007326006 | 6:41060123-41060145 | CCCTTCTCTTTTTTCTTCTCCTT | 0: 2 1: 6 2: 118 3: 963 4: 6176 |
||
| Right | 1007326009 | 6:41060152-41060174 | ACCAAAATTTTCAAAATTCCTGG | 0: 1 1: 0 2: 2 3: 28 4: 446 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1007326006 | Original CRISPR | AAGGAGAAGAAAAAAGAGAA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||