ID: 1007326006

View in Genome Browser
Species Human (GRCh38)
Location 6:41060123-41060145
Sequence AAGGAGAAGAAAAAAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7265
Summary {0: 2, 1: 6, 2: 118, 3: 963, 4: 6176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007326006_1007326009 6 Left 1007326006 6:41060123-41060145 CCCTTCTCTTTTTTCTTCTCCTT 0: 2
1: 6
2: 118
3: 963
4: 6176
Right 1007326009 6:41060152-41060174 ACCAAAATTTTCAAAATTCCTGG 0: 1
1: 0
2: 2
3: 28
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007326006 Original CRISPR AAGGAGAAGAAAAAAGAGAA GGG (reversed) Intronic
Too many off-targets to display for this crispr