ID: 1007326087

View in Genome Browser
Species Human (GRCh38)
Location 6:41061043-41061065
Sequence ATGTTGTGCTGGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007326087 Original CRISPR ATGTTGTGCTGGAAGAGTGA TGG Intronic
902748448 1:18489333-18489355 ATGTATTGAGGGAAGAGTGAGGG - Intergenic
904095581 1:27974539-27974561 ATGTTGTGCTGGAAGAGAGTGGG + Exonic
904843788 1:33392754-33392776 GTGTTGTGCAGGAAGAGAGAGGG - Intronic
905929425 1:41776848-41776870 AAGATCTGCTGTAAGAGTGAAGG - Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
907644283 1:56226169-56226191 ATGTTGTAATGGAAGAGTTCAGG + Intergenic
908291708 1:62673877-62673899 ACCTTGTACTGGAAGAGGGAGGG + Intronic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908770325 1:67590100-67590122 ATGTTGTGGTTTAAGAATGAAGG - Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910479119 1:87639368-87639390 GTGTTTTACTGGAAGAGAGAAGG - Intergenic
910851505 1:91653815-91653837 ATCTGGTGTTGGAAGAGTAAGGG + Intergenic
912444403 1:109724006-109724028 ATGTTGTATTGGAAGTTTGAAGG - Intronic
912848514 1:113100537-113100559 TTGTTGTGCTTAAAGTGTGATGG + Intronic
913304153 1:117406597-117406619 ATGTTGTGGTAGAGGAGTAAAGG + Intronic
915681668 1:157587321-157587343 GTGTGGTGCTGAAACAGTGAGGG - Exonic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920340016 1:205269752-205269774 ATGCTCTGCTGGAAGAGCTACGG + Exonic
921925446 1:220706900-220706922 ATGTTTGGCTGGGAGAGGGAAGG + Intergenic
923785905 1:237069118-237069140 TGGTTGTTCTGGAAGAGTGCTGG + Intronic
924266370 1:242286275-242286297 ATTTTGAGCTGAAGGAGTGAGGG + Intronic
1063201723 10:3790775-3790797 CTGTTGTGATGGAAGTGTGCCGG + Intergenic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066718461 10:38312280-38312302 ATTTTGAGCTGAAGGAGTGAAGG - Intergenic
1068120619 10:52779413-52779435 GTGTTGTGCTTGAGGAGGGAGGG - Intergenic
1068635694 10:59345725-59345747 ATTTTATCTTGGAAGAGTGAAGG + Intronic
1069831969 10:71287146-71287168 CTGTTGTCCTGGTAGAGTTAAGG + Intronic
1069979452 10:72242190-72242212 ATGCTGTGGGGGAAGAGTGAGGG + Intergenic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1076061603 10:127417874-127417896 ATCATGTGAAGGAAGAGTGATGG - Intronic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078315630 11:10291028-10291050 AAGTTGTTCTCAAAGAGTGATGG + Intronic
1079393274 11:20040553-20040575 ATGATGTGGGGGAAGAGTGTGGG - Intronic
1080931331 11:36814484-36814506 ATTTTTTGTTGGATGAGTGATGG + Intergenic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1081541597 11:44038556-44038578 CTGGTGTGCTGGGAGAGTTAAGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084514028 11:69626085-69626107 GTTTTGGGCTTGAAGAGTGATGG - Intergenic
1085466436 11:76726939-76726961 ATTTTGTGCTGAAGGAGAGAGGG - Intergenic
1085868191 11:80319621-80319643 ATGTTTTCCTGGAAGAGAGATGG - Intergenic
1086921791 11:92595821-92595843 ATGTTTTGCGGGAATAGTGTTGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1088820151 11:113449609-113449631 ATGCTGGGCTAGCAGAGTGACGG + Intronic
1089544830 11:119215902-119215924 ATTTTGTGCTGGAAGAATATAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090882842 11:130849307-130849329 AAGCTGTGCTGGCAGACTGAAGG - Intergenic
1092090057 12:5797075-5797097 GGTCTGTGCTGGAAGAGTGACGG - Intronic
1095994091 12:48064048-48064070 ATGTTGTGCTGAAAAAGAGAAGG - Intronic
1096230120 12:49892105-49892127 AGACTGTGCGGGAAGAGTGAGGG - Intronic
1096695713 12:53346876-53346898 GTGTTGTACTGGAAATGTGATGG - Intergenic
1096756873 12:53806944-53806966 ATCTTATGATAGAAGAGTGAAGG + Intergenic
1096876445 12:54633650-54633672 ATGTTGTGTTGAAAGAATAAAGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097541133 12:60945207-60945229 ATGTTTTGCTTGAAAAATGAAGG - Intergenic
1097904469 12:64905746-64905768 ATGTTGTGCTATACCAGTGAGGG - Intergenic
1100969046 12:100047089-100047111 ATGTAGTAGTGGAAGATTGAGGG - Intronic
1100991233 12:100253862-100253884 ACATTTTGCTGGATGAGTGAAGG + Intronic
1101027031 12:100619174-100619196 AAGTTGTGAGGGAAGATTGATGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102419929 12:112795443-112795465 TTGATGTGCTGAAAGAGTGAAGG + Intronic
1104096699 12:125564923-125564945 ATGTTGTGTGGGAGGTGTGAAGG + Intronic
1106096568 13:26650326-26650348 ATGCTGTGCTGGTAGGGTGTCGG - Intronic
1106571561 13:30932746-30932768 AGGTTGTGGTGGCAGAGAGAGGG - Exonic
1108107893 13:47032896-47032918 AACTGGTGCTGGAAAAGTGAAGG - Intergenic
1109237317 13:59840724-59840746 TGTTTGTGCTTGAAGAGTGATGG + Intronic
1111290549 13:86163141-86163163 ATGTTGTGGTAGAAGAGCCAGGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1121806857 14:96834849-96834871 ATCTTGTGATGGAGGAGAGATGG + Intronic
1122153468 14:99737073-99737095 ATGTGGTCCTGGCAGAGTGTGGG - Intergenic
1122963010 14:105107419-105107441 AAGTTGTGCTTCAAGAATGAAGG + Intergenic
1124659887 15:31538549-31538571 ATTTTGTCCTGGATGTGTGAGGG - Intronic
1126585032 15:50276743-50276765 ATGTGGTGCTGGAGCAGAGAAGG - Intronic
1127540758 15:59936646-59936668 ATATTGTACTAGAAGAGGGAGGG - Intergenic
1128833158 15:70787637-70787659 ATGTTGTTCTTTAAGAGTAAGGG + Intergenic
1128910641 15:71511042-71511064 ATGTTTTGCTGTAAGGGTCAAGG + Intronic
1130678788 15:85978301-85978323 ATGCTGTGAAGGAAAAGTGATGG + Intergenic
1132688195 16:1171044-1171066 AGGGTGTGCAGGAAGAGGGAGGG - Intronic
1133647661 16:7779344-7779366 ATGTAGGGCGGGAAGAGTGTGGG - Intergenic
1134871636 16:17657237-17657259 GGGGTGGGCTGGAAGAGTGAGGG + Intergenic
1136103779 16:28014171-28014193 ATTTTGTGCTGCAAGAATCAAGG + Intronic
1137915368 16:52424364-52424386 ATGCTGTGCTGGAAAATTGGAGG + Intergenic
1138347859 16:56331067-56331089 TTGTTGTGCTGGAAAGGAGAGGG + Intronic
1139932001 16:70535220-70535242 AAGTTGTGCTGAAAGAGAGGAGG + Intronic
1141962951 16:87421529-87421551 AGGCTGGGCTGCAAGAGTGAAGG + Intronic
1144668977 17:17120868-17120890 ATCTTGTGCTGCGAGAGTAAGGG - Intronic
1145010639 17:19365679-19365701 ATTTTGAGCTGGAGGGGTGAGGG - Intronic
1145018209 17:19412413-19412435 GGGTTGTGGTGGAAGACTGATGG - Intronic
1151222389 17:72622719-72622741 ATGTTGTAATGGAAGAGTATTGG + Intergenic
1155564843 18:27122656-27122678 AGGTGGAGCTGAAAGAGTGAAGG + Intronic
1155889976 18:31255599-31255621 ATGGAGTCCTGGAAGAGGGAAGG - Intergenic
1159897150 18:74008199-74008221 CTGTTGTGCAGCAAGGGTGAGGG + Intergenic
1159903733 18:74072001-74072023 ATGTTGGGATGGAGGAGGGAAGG - Intergenic
1159919665 18:74216105-74216127 ATGATGTTCTGGCAGAGGGAAGG - Intergenic
1160051737 18:75440054-75440076 GTGTTCTGCTGGAGGAGTAATGG + Intergenic
1160095044 18:75863589-75863611 CTGTTTTGGTGGAAGACTGAAGG - Intergenic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1162348366 19:10134453-10134475 ATCTTGTGCTGGAAGGGTTTTGG - Intronic
1164822311 19:31259692-31259714 ATCTTGAGTTGGAAGAATGAGGG - Intergenic
1166825649 19:45607373-45607395 AAGTTCTGCTGGAAAAGTGCTGG - Intronic
1167087455 19:47320114-47320136 ATGTTGAGCAGGATGAGGGAGGG - Exonic
928847087 2:35689267-35689289 ATGGTCTTCTGGAAGAGAGAGGG - Intergenic
929102846 2:38333336-38333358 AAATTGTCCTGGCAGAGTGAGGG + Intronic
929434564 2:41918629-41918651 CTGCTGTGCTGGAAGGGCGATGG + Intergenic
929531234 2:42754374-42754396 ATGTTGGGCTGGAGGGGTGGGGG - Exonic
929837672 2:45421779-45421801 CTTTTGTTCTGGAAGACTGAAGG + Intronic
931263871 2:60643318-60643340 ATGTTGATCTGGATGTGTGAGGG + Intergenic
932307071 2:70711639-70711661 TTGATGTGCTGGGAGAGTTATGG + Intronic
932591895 2:73072339-73072361 ATTTTGTGCAAGCAGAGTGATGG - Intronic
935083755 2:99824763-99824785 ACGTAGTGCTGGCAGAGGGAGGG + Intronic
936134814 2:109881545-109881567 GTGTTGACTTGGAAGAGTGAGGG - Intergenic
936209883 2:110489940-110489962 GTGTTGACTTGGAAGAGTGAGGG + Intergenic
936326410 2:111509327-111509349 ATGGTGTTCCGGAAGAGTCAAGG + Intergenic
936429074 2:112445195-112445217 GTGTTGACTTGGAAGAGTGAGGG + Intergenic
936630823 2:114200959-114200981 TTGTGTTGCTGGAAGAGTTAGGG + Intergenic
936833844 2:116682913-116682935 AGTTTGTGCTGGATGAGTCAGGG - Intergenic
936944144 2:117915340-117915362 ATGTTGGGCTGGCAGAGGGAGGG - Intergenic
938549962 2:132370814-132370836 ATGGGGTGCTGGAAGGGAGATGG + Intergenic
940267548 2:151855278-151855300 AAGTTGTGCTGGGTGATTGATGG + Exonic
941399642 2:165014961-165014983 ATGCTTTGCTGGGAGATTGAGGG + Intergenic
941942502 2:171057059-171057081 ATTTTGTGCTGTTAGAGGGAAGG - Intronic
945671606 2:212809024-212809046 ATGTGGTGCTGGAGTAGTCATGG - Intergenic
947522607 2:230859963-230859985 ATTTTATGGTGGAAGACTGAAGG + Intergenic
947693211 2:232159289-232159311 ATGGTGTCCTGCAAGAGTGGTGG - Intronic
948641472 2:239378352-239378374 ATGATGGCCTGGAAGAGGGAAGG + Intronic
1170464840 20:16613080-16613102 ATCTGGTGCTTGAAGACTGAAGG - Intergenic
1170679590 20:18514208-18514230 ATGTAGAGCTGGAAGACGGAGGG + Intronic
1170874076 20:20234532-20234554 AAGTTTTGCTGGAAAAGAGATGG + Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175125566 20:56748925-56748947 TTGTTGTTGTGTAAGAGTGAAGG + Intergenic
1175782658 20:61693337-61693359 ATGCTGTGCTGGAAATGTGGGGG + Intronic
1184928720 22:47663718-47663740 AGGTTGTGCTTGCAGAATGAGGG + Intergenic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953900458 3:46838092-46838114 GTCTACTGCTGGAAGAGTGAGGG + Intergenic
954988537 3:54817613-54817635 ATGTTGTGTTTCAAGAGTCAAGG + Intronic
956377522 3:68631571-68631593 ATGTTTTGCTAAGAGAGTGAGGG - Intergenic
958753939 3:98227832-98227854 GTGTTTTCCTGGAAGATTGAAGG + Intergenic
959523759 3:107351561-107351583 ATGTGGTGCTGGAACAAAGATGG - Intergenic
960231288 3:115230325-115230347 ATGGTGGGCTGGGAGAGGGAAGG + Intergenic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
961589335 3:127964309-127964331 ATCATGTGCTTAAAGAGTGAAGG - Intronic
963597922 3:147351488-147351510 ATGCTGTGCTGCAAAACTGAGGG - Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
965892428 3:173530387-173530409 TTGTCGTCCTGGAAGAGAGAGGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967598273 3:191353642-191353664 AGGTTGTGCTAGAATACTGATGG + Intronic
968149917 3:196329333-196329355 ATGTTGTGAAGTAATAGTGAAGG - Intronic
969739715 4:9015529-9015551 ATGTTGGGCTGGTAGAGCCAGGG - Intergenic
971643407 4:29164665-29164687 ATGCCGTACTGGAAGTGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973182744 4:47289656-47289678 CTGGTGTACTGGATGAGTGATGG + Intronic
973972643 4:56228822-56228844 ATATTGTGATAGAAGAATGATGG + Intronic
976009536 4:80470750-80470772 ATGTTCTGCTGGATGAAAGATGG - Intronic
976403092 4:84629963-84629985 AGGCTGTGCTGGGAGAGTCAAGG + Intronic
979392256 4:120141143-120141165 ATGGAGAGCTGGAAGAGGGATGG - Intergenic
981509813 4:145543657-145543679 ATGTAGAGCTGGAAGAATGATGG - Intronic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
982907338 4:161091189-161091211 CTGTTCTGATGGAAGAGTCAGGG - Intergenic
983784993 4:171719076-171719098 CTGTTGTGCTGGAAGGGTTAAGG - Intergenic
985302264 4:188503380-188503402 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302371 4:188504229-188504251 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302454 4:188504955-188504977 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302656 4:188506526-188506548 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302755 4:188507313-188507335 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
985302771 4:188507434-188507456 ATAAGGTGCTGGAAGAGAGAGGG + Intergenic
987525631 5:19045709-19045731 ATGTTCTGATGGAAGTGTCAGGG - Intergenic
988744044 5:34114791-34114813 ATGATGTGTTAGAAGAGAGATGG - Intronic
988907944 5:35809394-35809416 TTTTTGTGCTGGAAGTGTGGAGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
994642997 5:102433624-102433646 ATGCTGTGCTGGAGGGGTCAAGG + Intronic
995154885 5:108898884-108898906 ATTTTGTGCTGGGAGTGTGAAGG - Intronic
995748486 5:115428892-115428914 ATGCTGTGCTGGAAGAGACGAGG - Intergenic
997414489 5:133714677-133714699 ATGGTGTTCTGGGAGAGTAAAGG - Intergenic
998299772 5:141006646-141006668 ATGGTGTCCTGAAAGAGTGGTGG + Intronic
1001552129 5:172610769-172610791 AGGGTGTGTTGGAAGACTGAGGG + Intergenic
1004975041 6:20955850-20955872 TTTATGTGCTGGAAGACTGAAGG - Intronic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008700224 6:54090242-54090264 ATTTTCTGCTGGAAGAGTCATGG - Intronic
1008806358 6:55433674-55433696 ATGTTGAGTTGCAAGAATGAAGG + Intergenic
1009823425 6:68835585-68835607 AATTTGAGCTGGAAGAGTCAGGG - Intronic
1011508354 6:88072697-88072719 TTGTTGCTCTGGAAGAGAGAAGG - Intergenic
1011591854 6:88977513-88977535 TTGTTGTGTTGGCAGAGGGAAGG - Intergenic
1012217415 6:96604630-96604652 AGGTTGTGCTAGTAGCGTGAGGG - Intronic
1012219468 6:96630877-96630899 ATGCTTTGCAGGAAGAATGAGGG - Intergenic
1012499843 6:99876185-99876207 ATATTGTGTTGGAAGAGAGTTGG + Intergenic
1012976167 6:105783401-105783423 ATGGAGTGCTAGAAGAGTGCTGG - Intergenic
1013508930 6:110827042-110827064 AGGTTATGCTGGACTAGTGAGGG - Intronic
1013755422 6:113456083-113456105 ATGTTATGCTGTAAAGGTGATGG - Intergenic
1014956905 6:127630910-127630932 ATGTTATGCTTCAAGAGAGAAGG - Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1026636248 7:72084355-72084377 ATTTTCTGCTGGAAGATTTATGG - Intronic
1027569555 7:79847237-79847259 ATGCAGAGCTGGAAGAGGGATGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030066717 7:105665160-105665182 AGGTGCTGCTGGCAGAGTGATGG + Exonic
1030594815 7:111525274-111525296 ATGTTGTGATGGACAACTGAAGG + Intronic
1033801098 7:144903301-144903323 ATTATGTGCTGGAACTGTGATGG + Intergenic
1036945719 8:13092639-13092661 GTGTTGAGATGGAAGAGGGAAGG + Exonic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1041332441 8:56741309-56741331 ATGTTGTGATGGAAGAACAATGG - Intergenic
1042601441 8:70503192-70503214 ATGGGAAGCTGGAAGAGTGATGG + Intergenic
1043131093 8:76462343-76462365 ATTTTGGGCTAGAAGAGTTACGG - Intergenic
1044476574 8:92633365-92633387 ATGTTGTGCTGGCAGAGGAGAGG - Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1048754776 8:137726956-137726978 ATGTTGTCCTGGAATTGTCAAGG + Intergenic
1049315994 8:141968000-141968022 ATGTTGGGGTGGAAGTGGGAGGG + Intergenic
1050124358 9:2341244-2341266 ATGTTGGGCTGAGAGAGAGACGG + Intergenic
1050171133 9:2818146-2818168 TTTTTGTGGTGGATGAGTGATGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050790701 9:9465239-9465261 TTGTTTTATTGGAAGAGTGATGG - Intronic
1051411878 9:16798077-16798099 TTGTTGATCTGGAAGTGTGAAGG + Intronic
1051898412 9:22012392-22012414 TAGGTGAGCTGGAAGAGTGAAGG - Intronic
1052104426 9:24495068-24495090 ATGTTTTACTGGGAGAGTTAGGG - Intergenic
1052548851 9:29921143-29921165 ATGTATTGTTGGAAGACTGACGG + Intergenic
1055506060 9:76950701-76950723 GTGTTGGGGTGGAAGAGTTAGGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1062039411 9:134397171-134397193 AGGGTCTGCTGGAAGAGGGAAGG - Intronic
1062416674 9:136454686-136454708 ATGTTGAGTCGGAAGAATGAAGG - Intronic
1185685085 X:1922199-1922221 CTCTTGAGCTGTAAGAGTGAAGG - Intergenic
1194042039 X:88952901-88952923 ATGTTCTGCTTCAAAAGTGAAGG + Intergenic
1194986537 X:100495801-100495823 AGGTAGTGCTGGAAGCCTGAAGG + Intergenic
1195492073 X:105482482-105482504 ATGATGTGTTGGAAAAATGAAGG + Intronic
1195771651 X:108357835-108357857 ATGTTGTCCTAGAATAGGGATGG + Intronic
1196216558 X:113059262-113059284 ATGATGTGCAGTAAGAGTCAAGG + Intergenic
1197758382 X:130011790-130011812 AAGTGGTGCTGGGAGACTGATGG + Intronic
1201589093 Y:15593836-15593858 GTGCTGTGCTAAAAGAGTGAGGG - Intergenic