ID: 1007326176

View in Genome Browser
Species Human (GRCh38)
Location 6:41061692-41061714
Sequence CTGAAGAAGCTGAAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 678
Summary {0: 1, 1: 0, 2: 6, 3: 69, 4: 602}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007326172_1007326176 -5 Left 1007326172 6:41061674-41061696 CCGGAGATCCAGGCTGCTCTGAA 0: 1
1: 0
2: 2
3: 38
4: 509
Right 1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG 0: 1
1: 0
2: 6
3: 69
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007326176 Original CRISPR CTGAAGAAGCTGAAGGAGGC TGG Exonic
900530195 1:3149281-3149303 CTGAAGAAGATGAAGCAGGCAGG + Intronic
900703335 1:4061275-4061297 CTCTAGAAGCTGGAAGAGGCAGG + Intergenic
900942382 1:5808359-5808381 CTGAAGAAGCTGAAGGCACTGGG + Intergenic
901038380 1:6349789-6349811 CTGAAGATGATCGAGGAGGCAGG - Exonic
901070551 1:6515229-6515251 CTAAAAAAGCTGGATGAGGCCGG + Intronic
902645749 1:17796752-17796774 CTGAAGAAGCTTGAAGAGGTCGG - Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903290581 1:22311566-22311588 GTAAAGAAGCTGAAGAAGCCAGG + Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903391317 1:22965355-22965377 CAGAAGAAGCTGCAGATGGCCGG + Intergenic
903527432 1:24002513-24002535 ATGAAGAAGATAAAAGAGGCCGG + Intergenic
903962959 1:27068468-27068490 CTAAAGAAGCTGAAACAGGCTGG - Intergenic
904503160 1:30929388-30929410 CTGCAGACGCTGGAGGAAGCAGG + Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
904886839 1:33744403-33744425 CTGAAGAAACTGGGGGAGGGAGG + Intronic
904899088 1:33842156-33842178 TTGAAGGAGATGAAGGAGTCAGG - Intronic
905477372 1:38238523-38238545 CTGAAGGAAATGAAGGAGACAGG - Intergenic
906346351 1:45017718-45017740 CTGAAGAGGCTGTGTGAGGCAGG + Exonic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907337025 1:53706515-53706537 CAGAAAATGCTGAAGGCGGCAGG - Intronic
907352905 1:53848154-53848176 CTGAAGAAGCTGGAGTAACCAGG - Intergenic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
908175745 1:61553510-61553532 CTGAAGATTCTCAAGGATGCAGG - Intergenic
909728749 1:78868546-78868568 CTAATTAATCTGAAGGAGGCAGG + Intergenic
910692099 1:89975332-89975354 CTGAAGTAGCTAAATGAGGGTGG + Intergenic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911104626 1:94119999-94120021 CTAAAGGAGCTGAAAGAGGAAGG - Intronic
912308982 1:108599882-108599904 CTCAAGAGGCTGAGTGAGGCAGG + Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913023765 1:114813782-114813804 CTCAAGAAGCTGAAGTAGGAGGG - Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913962611 1:143351989-143352011 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
914056966 1:144177574-144177596 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
914122180 1:144788792-144788814 CTAAAGAATGTGCAGGAGGCTGG - Intergenic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915164473 1:153941021-153941043 CTGCAGCAGCTGCAGGAAGCTGG + Exonic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916362182 1:163982979-163983001 CTCAAGAAGCTCCAGGAGGTAGG + Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917145905 1:171891166-171891188 ATAAGGAAGGTGAAGGAGGCAGG + Intronic
918067643 1:181112319-181112341 CTGAAGAAACAGAAGCAGACAGG - Intergenic
918422066 1:184374230-184374252 CTCAAGAAGCTGAGGCAGGCCGG + Intergenic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919038002 1:192341082-192341104 CTCTAGAAGCTGAAAAAGGCAGG - Intronic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
919989862 1:202702262-202702284 CTGCTGCAGCTGCAGGAGGCAGG - Intronic
920130358 1:203727422-203727444 CTGAAGTTCCTGAAGGAGGCTGG + Exonic
920649539 1:207826418-207826440 ATGAGGAGGCTGGAGGAGGCAGG + Intergenic
921326541 1:213989895-213989917 CTTAAATAGCTCAAGGAGGCAGG + Intronic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922223934 1:223628930-223628952 CAGAAGAAGCTGATGGCTGCGGG - Intronic
922308080 1:224361879-224361901 CTCAAGAAGCTACATGAGGCTGG - Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
923701835 1:236307149-236307171 TTGAAAAATCTGAAGGAGCCAGG + Intergenic
923764752 1:236882687-236882709 TTCAAGATGGTGAAGGAGGCCGG - Intronic
924082697 1:240415940-240415962 GAATAGAAGCTGAAGGAGGCTGG - Intronic
924499813 1:244626724-244626746 GTGAAGAAGCTGCAGAAGGAAGG - Intronic
924769305 1:247064914-247064936 CTTGAGAGGCTGAGGGAGGCAGG - Intronic
924828231 1:247564255-247564277 CTCAAGAAGTTGAAAGAAGCTGG + Intronic
1062832607 10:616034-616056 CTGAAGACGCTGAGAAAGGCTGG + Intronic
1062977584 10:1696841-1696863 CTCTAGAAGCTGGTGGAGGCTGG - Intronic
1063518159 10:6716748-6716770 GTAAAGATGCTGAAGGAGGTAGG + Intergenic
1063771494 10:9207796-9207818 ATTAAGAACCAGAAGGAGGCTGG - Intergenic
1064102797 10:12477731-12477753 GGGAAGAAGCTGAAGGCGGAGGG + Intronic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1066963586 10:42242251-42242273 CGCAAGGAGCTGAAGGCGGCTGG - Intergenic
1068636436 10:59353129-59353151 CTGAAGAAGATGGAAGAGGGCGG + Intronic
1069028614 10:63571399-63571421 CTGTAGAAGCTGGAGTAGACAGG - Intronic
1069491307 10:68863347-68863369 CCGAAGAACCTGAGGAAGGCGGG - Intronic
1069698278 10:70404032-70404054 CTGAAGTTGTTGAAGGGGGCGGG - Intergenic
1069897421 10:71688324-71688346 CTGCAGTGGCTGAAGGAGACAGG + Intronic
1071465024 10:85931905-85931927 CTGGAGAAACTGAAGGACTCTGG - Intronic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072846419 10:98836353-98836375 TTGAAGGGTCTGAAGGAGGCAGG - Intronic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073299645 10:102463101-102463123 CTGAGCAAGCTGAGGGAGCCTGG + Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073718943 10:106143036-106143058 CAGAAGATGCTGAAGGCAGCTGG - Intergenic
1074388556 10:113037130-113037152 TTGTAGAAGATGAAGGAAGCTGG + Intronic
1075015942 10:118910070-118910092 CTCTAGAAGCTGGAAGAGGCAGG + Intergenic
1075117826 10:119641840-119641862 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075398300 10:122143331-122143353 CTACAGAAGCTTAAGGAGGGAGG + Intronic
1075603200 10:123785927-123785949 CTTAAGAAGCTAAAGTGGGCTGG - Intronic
1075627597 10:123973737-123973759 CTGAAGGAGCTGGATGGGGCTGG - Intergenic
1076298224 10:129403798-129403820 CTGACGAAGCTGAGAGACGCTGG - Intergenic
1077327720 11:1970934-1970956 CAGAAGGAGCTGAGGGTGGCAGG + Intronic
1077825269 11:5801127-5801149 GTGAAGAAGTTGAAAAAGGCTGG - Intronic
1078008463 11:7550489-7550511 CTGAAGAAGCTGCAAGACACAGG - Intronic
1078195970 11:9137446-9137468 GTGCAGAAGCTGAGGCAGGCAGG + Intronic
1078415318 11:11160156-11160178 CTCTAGAAGCTGAAAAAGGCAGG - Intergenic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080855724 11:36110043-36110065 TCGAAGAAACTGAAGGAGGCTGG + Intronic
1081677638 11:44980284-44980306 CTGGAGAAGCTGTAGTTGGCAGG - Intergenic
1081713417 11:45232533-45232555 CTGAAACAGCTGAAACAGGCAGG + Intronic
1081828052 11:46077733-46077755 CTGAAGAATCTGAGGTAGGCAGG - Intronic
1084054671 11:66624758-66624780 GTGAAGAAGCTGCAGCAGACTGG - Exonic
1084124877 11:67092807-67092829 CTCAAGAGGCTGAAGCAGGCTGG - Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084447713 11:69213335-69213357 CCCCAGAAGCTGAAGGAGGCGGG + Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1085324237 11:75594449-75594471 ATGAAGAATCTGCAGGAGACAGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087132972 11:94684827-94684849 TTAAAGAAGCTCAATGAGGCTGG + Intergenic
1087513646 11:99129487-99129509 CTGAAGTACCTGAAAGAGACAGG + Intronic
1088392462 11:109329889-109329911 CTGAAGAAACTGAAAGTTGCTGG - Intergenic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1090234000 11:125133081-125133103 CTGAAGAGGGTGAAGGACTCTGG + Intergenic
1090572384 11:128061453-128061475 CAGAAGAACTTGAATGAGGCTGG + Intergenic
1090941838 11:131393870-131393892 CTTAATAGGCTGAAGGAGGTAGG - Intronic
1202810702 11_KI270721v1_random:26114-26136 CAGAAGGAGCTGAGGGTGGCAGG + Intergenic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1092202079 12:6591719-6591741 CTCAAGAACCTTAAGGAGGGTGG - Exonic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092828641 12:12422315-12422337 ATTAAGAAAGTGAAGGAGGCCGG + Intronic
1093082217 12:14825896-14825918 CTGAAGAAGCTGATTGAAACAGG - Exonic
1093115035 12:15198708-15198730 TTCTAGAAGGTGAAGGAGGCAGG - Intronic
1094441998 12:30488075-30488097 CTAAAGAAACTGAACTAGGCCGG - Intergenic
1094465812 12:30753601-30753623 CAGATGAGGCTGAAGGAGGTGGG + Exonic
1094522629 12:31208946-31208968 CTGTAGAGGATGAAGGAAGCAGG - Intergenic
1096331964 12:50721292-50721314 CTTATGAAGCTGAAGGCAGCTGG - Exonic
1096696118 12:53349743-53349765 CTCAAGAGGCTGAGGTAGGCCGG + Intergenic
1096972210 12:55676134-55676156 CTCAAGAGGCTGAAGCAGGAAGG + Intergenic
1097050427 12:56219907-56219929 CTGAGGAGGCTGAAGGGGGAAGG + Intronic
1097180351 12:57168283-57168305 CTGGAGAACCTGCAGGGGGCTGG - Intronic
1097734021 12:63162355-63162377 CCAAAGAAACTGAAGGAGGAGGG + Intergenic
1097903418 12:64896069-64896091 ATGAAAAAGCTGAGGGGGGCAGG - Intergenic
1098934495 12:76462765-76462787 CTGAATAAGATGAAGGAACCTGG + Intronic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099343881 12:81473491-81473513 CTGATGAAGCTGTAGGAAGATGG - Intronic
1099619604 12:84984469-84984491 CTCAGGAAGCTGAAGGTGGGAGG - Intergenic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099955759 12:89351663-89351685 CTCAAGAAGCTCAAGGACGAGGG - Exonic
1099972280 12:89512646-89512668 CTCCAGAGGCTGAGGGAGGCGGG + Intronic
1100543166 12:95577048-95577070 CAAAAGAAACTGAAGCAGGCCGG - Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1101003047 12:100375311-100375333 GGGAAGGAGCTGGAGGAGGCTGG + Intronic
1102050754 12:109860272-109860294 CTTAAGAAGATAAACGAGGCTGG - Intronic
1102362828 12:112303137-112303159 CTGAAGAAACTGAATGACCCTGG - Intronic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1103631845 12:122267829-122267851 TAGAAGATGCTGGAGGAGGCCGG - Intergenic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104777701 12:131400971-131400993 CAGAAGAGGATGAAGGGGGCGGG - Intergenic
1106485850 13:30171904-30171926 TTGATGAAGATGAAGCAGGCAGG + Intergenic
1107507670 13:41050843-41050865 CTAAAAAATCTGAAAGAGGCCGG - Intronic
1108176593 13:47798740-47798762 CTGGAGAGGCAAAAGGAGGCAGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1109344245 13:61095766-61095788 CAGAAGAAGCTGAAAGAGGCTGG - Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111424029 13:88056086-88056108 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112409260 13:99148169-99148191 CTCAGGAGGCTGAAGCAGGCAGG - Intergenic
1112938176 13:104826799-104826821 CTGAACAACCTGATGGATGCTGG - Intergenic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1115852021 14:37596192-37596214 CTGAAGCGGCTGAAGGGGGGCGG - Intronic
1116342594 14:43743938-43743960 CTGAATAACCTAAAGGTGGCAGG + Intergenic
1118443619 14:65833057-65833079 CTAAGGAAGCTGCAGGAAGCTGG + Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118839649 14:69500919-69500941 CTGGAGATGCTGCAGGAGTCTGG + Exonic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1120342287 14:83236955-83236977 CTGAGGAAGCTCTGGGAGGCTGG - Intergenic
1120676143 14:87423507-87423529 CTGGAGAAGCTCAAGGGGTCAGG + Intergenic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1120968783 14:90190692-90190714 CTGATGATGCTGAATGAGGCGGG - Intergenic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1123068406 14:105629407-105629429 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123098003 14:105775432-105775454 CTGAACAGGCTGCAAGAGGCTGG - Intergenic
1123141799 14:106087197-106087219 CTGAACAGGCTGAAGATGGCCGG + Intergenic
1123441509 15:20295179-20295201 CGCAAGGAGCTGAAGGCGGCGGG + Intergenic
1123674063 15:22690641-22690663 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1123874814 15:24613212-24613234 ATTAAGAAACTAAAGGAGGCTGG + Intergenic
1124232264 15:27955817-27955839 CTGAAGGGGCTGAAACAGGCGGG - Intronic
1124326071 15:28763633-28763655 CTGAAGCTTCTGAAGGAGGATGG - Intergenic
1125722977 15:41853944-41853966 GAGAAGAGGCTGAAGCAGGCTGG + Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1127476047 15:59334171-59334193 CTCAGGAAGCTGAAGCAGGAGGG + Intronic
1127485856 15:59417025-59417047 CTGAAGAGGATGATGGGGGCTGG + Intronic
1128502546 15:68237377-68237399 CTGAGGAAGCTGAAGCTGGAGGG + Intronic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1129379932 15:75158470-75158492 CTGAAGAGTCTGAGGGAGACAGG - Intergenic
1129878332 15:78991649-78991671 CTGAGGAAGCGGGGGGAGGCGGG + Intronic
1130016118 15:80187698-80187720 CTAAAGAACATCAAGGAGGCTGG + Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1130857813 15:87856875-87856897 CTCAGGAGGCTGAAGCAGGCAGG + Intergenic
1133328131 16:4954754-4954776 CTGAAGAAGATGCAGTAAGCAGG - Intronic
1134222005 16:12362394-12362416 CTGCAGCAGGTGGAGGAGGCTGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136028389 16:27484958-27484980 CTGGTGCAGCTGGAGGAGGCAGG - Intronic
1136231076 16:28885786-28885808 TTGAGGAGGCTGAAGGAGACAGG - Intronic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136477714 16:30524052-30524074 CTGAGGAAGAAGAGGGAGGCTGG + Exonic
1136548178 16:30966932-30966954 AAGACGAAGCTGAAGGAGCCTGG + Exonic
1136719700 16:32310341-32310363 CACAAGGAGCTGAAGGCGGCGGG - Intergenic
1136724737 16:32348740-32348762 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1136838075 16:33516621-33516643 CGCAAGGAGCTGAAGGCGGCGGG - Intergenic
1136843063 16:33554780-33554802 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1137312871 16:47283605-47283627 CTTAAGAAGCTGGAAAAGGCAGG + Intronic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137775134 16:51047933-51047955 CTGAGGGGGCTGAGGGAGGCTGG + Intergenic
1138203239 16:55105592-55105614 GCAAAGAAGCTCAAGGAGGCTGG + Intergenic
1138588568 16:57986886-57986908 TTGAAGAGCATGAAGGAGGCCGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140948947 16:79797523-79797545 CACCAGAAGCTGGAGGAGGCCGG + Intergenic
1141158519 16:81613235-81613257 CTGATGAAGCAGGAGGAGGAAGG - Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1203001693 16_KI270728v1_random:169015-169037 CGCAAGGAGCTGAAGGAGGTGGG + Intergenic
1203006731 16_KI270728v1_random:207428-207450 CACAAGGAGCTGAAGGCGGCGGG + Intergenic
1203133297 16_KI270728v1_random:1705421-1705443 CGCAAGGAGCTGAAGGAGGTGGG + Intergenic
1203148248 16_KI270728v1_random:1816901-1816923 CGCAAGGAGCTGAAGGCGGCGGG - Intergenic
1203153228 16_KI270728v1_random:1855078-1855100 CGCAAGGAGCTGAAGGAGGTGGG - Intergenic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142646129 17:1315072-1315094 CTGATGCATCTTAAGGAGGCAGG - Intergenic
1142879467 17:2873161-2873183 ATAAAGAAGCTGCAGTAGGCTGG + Intronic
1142953077 17:3500136-3500158 GTGAGGAAGCTGCAGGAAGCTGG + Exonic
1144535812 17:16090120-16090142 CTGAAGAAACTGAACCAGGCTGG - Intronic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1144862598 17:18314996-18315018 CGGAAGTAGCTGGAGAAGGCGGG - Exonic
1145207090 17:20990338-20990360 CACCAGAAGCTGGAGGAGGCAGG - Intergenic
1145981241 17:29012965-29012987 ATCAAGAAACTGAGGGAGGCTGG + Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146460981 17:33045874-33045896 CTGAAGAATCTGAAGAGGTCAGG + Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1146718607 17:35107015-35107037 CTGAAGCAGCTGGAGGAGGCGGG + Exonic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1148058396 17:44816611-44816633 CTCGAGAAGCTGACTGAGGCAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148713726 17:49700518-49700540 CTTCAGCAGCTGGAGGAGGCAGG + Intergenic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149116639 17:53105234-53105256 CTGTAGAAGCTGGAAAAGGCAGG + Intergenic
1149156319 17:53633899-53633921 CTGAAGGATCTGGAGGAGTCTGG - Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151733589 17:75925194-75925216 CTGCAGGTGCTGAAGGAAGCGGG - Intronic
1151813651 17:76460104-76460126 CTGAAGTAGGTGACTGAGGCTGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152137112 17:78510999-78511021 CCCCAGAAGCTGGAGGAGGCAGG + Intronic
1152401533 17:80069448-80069470 CTGAGGAAGCTGAAGGGGTCAGG + Intronic
1152563874 17:81091585-81091607 CTGAAGACCCTGAGAGAGGCAGG + Intronic
1152593640 17:81227253-81227275 CTTAAGAAACTGAAAAAGGCTGG + Intergenic
1152930474 17:83107180-83107202 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1153496022 18:5700441-5700463 CTGAAGAAGCTGAAAGGAGATGG + Intergenic
1154206119 18:12338430-12338452 CTGAAGAAGCTGATCCAGTCTGG + Intronic
1155425222 18:25700022-25700044 CTGGAGAAGCTGGAGAAGCCAGG - Intergenic
1155561248 18:27079781-27079803 CTCTAGAAGCTGCAGAAGGCCGG - Intronic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159247278 18:65823822-65823844 CAGAAGTAGATGCAGGAGGCAGG + Intronic
1159902798 18:74063791-74063813 TTGAAGAAGCGGAAGGTGACAGG - Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160909089 19:1466590-1466612 CTGGAGGGGCTGGAGGAGGCCGG + Exonic
1161133385 19:2605083-2605105 CCCCAGAAGCTGGAGGAGGCAGG - Intronic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1162337045 19:10068174-10068196 CTGCAGGAGATGATGGAGGCCGG + Intergenic
1162402787 19:10456092-10456114 CTTAAGAACCTGTAAGAGGCAGG + Intronic
1163002753 19:14379024-14379046 CTGCAGAATCTCAGGGAGGCAGG - Intergenic
1163538703 19:17893794-17893816 CAGAAGGAGCTGGAGGGGGCTGG + Exonic
1163634136 19:18430659-18430681 CTGAAGACCCTGTAGGACGCAGG - Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164400046 19:27896116-27896138 TTACAGAAGGTGAAGGAGGCAGG - Intergenic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164809806 19:31147138-31147160 GGGAAGAAGCTGTAGGGGGCTGG + Intergenic
1165121390 19:33561109-33561131 CTGAAGGAGCTGGAGGGGCCTGG + Intergenic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1166362843 19:42262041-42262063 CTGAAGATGCTGAAGGCACCAGG + Intergenic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167660924 19:50795584-50795606 CTGTAGAAGCTGAAACAGGAGGG - Intergenic
1168084463 19:54035141-54035163 CTGGACAATTTGAAGGAGGCAGG + Intergenic
1202696449 1_KI270712v1_random:130247-130269 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
925599765 2:5596348-5596370 GTGAAGAAGTGGGAGGAGGCTGG - Intergenic
925640401 2:5981428-5981450 CTTCAGGCGCTGAAGGAGGCAGG + Intergenic
925640488 2:5981849-5981871 CTGACTCAGCTGAAGGGGGCTGG + Intergenic
925999717 2:9320793-9320815 CAGATGAATCTGAAGGAGACAGG - Intronic
926253581 2:11170350-11170372 CTGAAGAGGCTGATGCTGGCAGG + Intronic
927079843 2:19616581-19616603 GTGAAGAAACTTAAAGAGGCTGG + Intergenic
927641388 2:24847848-24847870 CTGAGGAGTCTGGAGGAGGCAGG + Intronic
928833016 2:35511651-35511673 CTGGTGAAGGTTAAGGAGGCAGG - Intergenic
928979970 2:37127462-37127484 ATGAGGATGCTGAGGGAGGCAGG - Intronic
929209651 2:39341360-39341382 CTGAAAAAACTTCAGGAGGCCGG + Intronic
930833391 2:55769781-55769803 CTGAAGAACCCAGAGGAGGCTGG + Intergenic
931366640 2:61624939-61624961 CAGAAGAAGCTGTAGGATTCTGG + Intergenic
931773492 2:65519596-65519618 CTGAAGAAGATGTTGGAGGTGGG - Intergenic
932553170 2:72793571-72793593 CTGAACTAGCTGGAGGAGTCAGG + Intronic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
933129645 2:78656346-78656368 CTGGAGCACCTGAAGGAGACAGG + Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934277611 2:91587272-91587294 CTAAAGAATGTGCAGGAGGCTGG + Intergenic
934321420 2:91974886-91974908 CGCAAGGAGCTGAAGGCGGCGGG + Intergenic
934947420 2:98551830-98551852 CTGAGGAAGCTGAAGAAAGCAGG - Intronic
935198469 2:100835363-100835385 CTGCTGAAGCTAAAGAAGGCAGG - Intronic
935786051 2:106549907-106549929 CTCCAGAAGCTGGAAGAGGCAGG - Intergenic
936344029 2:111661639-111661661 AGGAAGAAGCTGAAAGAGACAGG - Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
936918099 2:117660774-117660796 CTGAGGAACAAGAAGGAGGCTGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938899059 2:135783139-135783161 AATAAGAAGCTGATGGAGGCAGG - Exonic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939522764 2:143252138-143252160 CAGAAGAAACTGAAAAAGGCTGG - Intronic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941203109 2:162539035-162539057 CTGAAGAAGCTGAAGACTGAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941932651 2:170957570-170957592 ATGAAGAAAAGGAAGGAGGCTGG - Intronic
942530199 2:176901827-176901849 CTGAAGAAATTGCATGAGGCTGG - Intergenic
943179177 2:184521443-184521465 CTCAAGAAGCTGAAAGAGCCAGG + Intergenic
946068979 2:217014888-217014910 CATGAGAAGCTAAAGGAGGCTGG + Intergenic
946087300 2:217186906-217186928 CTGGGGAAGCTGGAGGAAGCAGG - Intergenic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946842726 2:223834647-223834669 CTCAAGAAGCTGAGGTAGGAGGG + Intronic
946954270 2:224911626-224911648 AGGCAGGAGCTGAAGGAGGCTGG + Intronic
947640422 2:231704670-231704692 CTCAGGAGGCTGAGGGAGGCAGG + Intergenic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948892891 2:240915824-240915846 CTGAAGAAGGTGCTGGGGGCAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172293317 20:33791269-33791291 CTGGAGGAGCTGAAGGACACAGG + Exonic
1172389541 20:34557815-34557837 CTGAGGAGGCTGACTGAGGCAGG + Intronic
1172555226 20:35834978-35835000 CTCAAGAAGAGGTAGGAGGCCGG + Intronic
1172733566 20:37109074-37109096 CTCAAGAGGCTGAGGGAGGTAGG + Intronic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1174368326 20:50069727-50069749 CTAAAGAAGCTCAGGCAGGCAGG + Intergenic
1174372295 20:50099665-50099687 CTAAAGAAGCTGAGGGAGCTTGG - Intronic
1174476498 20:50799648-50799670 CTGAAGGTGCTGAATGAAGCAGG - Intronic
1174609530 20:51787801-51787823 CTTAAGAAGCTGAAAAGGGCCGG - Intronic
1174814562 20:53675466-53675488 TTTAGGAAGCTGAAGCAGGCTGG - Intergenic
1174885286 20:54327571-54327593 CACCAGAAGCTGCAGGAGGCAGG - Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175503165 20:59464499-59464521 GTGAAGAAGCTGCAGGTGGCTGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175978337 20:62724795-62724817 CTCCAGGAGCTGCAGGAGGCAGG - Intronic
1176020248 20:62959008-62959030 CTGCAGGAGCTGGAGGAGGAGGG + Intronic
1176293860 21:5060238-5060260 CTGCAGACGCTGGAGAAGGCGGG - Intergenic
1176308943 21:5139629-5139651 ATGGAGAAGCTGCAGGAGCCTGG + Intronic
1177505699 21:22015155-22015177 ATGAAGAACTTGAAAGAGGCAGG - Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178506482 21:33167100-33167122 CTCCAGAAGCTGGAAGAGGCTGG + Intronic
1178925629 21:36772686-36772708 CTCAAGAAGGTGGAAGAGGCCGG + Intronic
1179261201 21:39759568-39759590 CTGAAAAAGCTGAGGCAGGCTGG + Intronic
1179848118 21:44122404-44122426 ATGGAGAAGCTGCAGGAGCCTGG - Intronic
1179863399 21:44203410-44203432 CTGCAGACGCTGGAGAAGGCGGG + Intergenic
1180136926 21:45867993-45868015 CTGAAGAGGCCACAGGAGGCTGG + Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180565048 22:16656422-16656444 CTCAAGAAGCTGGGGGAGGGGGG - Intergenic
1180701115 22:17781857-17781879 CTGCAGAAGCTCTGGGAGGCTGG + Intergenic
1181294758 22:21827960-21827982 GAAAAGAAGCTGAAGAAGGCAGG + Intronic
1181737751 22:24895026-24895048 CTGAAGAGGCTCCAGGAAGCAGG + Intronic
1182018986 22:27065132-27065154 CTGAAAGAGCTGCAGGATGCTGG - Intergenic
1182663030 22:31938444-31938466 CTGAACAAGCTGGAGGGGGGCGG + Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1182905609 22:33933402-33933424 CTGTAGAAACTGCAGGAGCCTGG - Intergenic
1183269413 22:36851281-36851303 GTGAAGACGCTGACAGAGGCTGG + Intergenic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183948504 22:41339951-41339973 ATGACCAAGCCGAAGGAGGCGGG - Exonic
1183971219 22:41478974-41478996 CTGCAGAAGGTCAAGGAGCCCGG - Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184379418 22:44135771-44135793 CACCAGAAGCTGGAGGAGGCAGG - Intronic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184974198 22:48049417-48049439 CTGAAGAAACTGCAGCAGGTTGG - Intergenic
1185088077 22:48751397-48751419 CTCAGGAAAATGAAGGAGGCTGG - Intronic
1185369071 22:50451231-50451253 CTCAAGAGGCTGAATGAAGCAGG + Intronic
949115444 3:315718-315740 CTGGAGAACCTGAGGGAGTCAGG + Intronic
950770280 3:15305712-15305734 TGCAAGAAACTGAAGGAGGCCGG + Intronic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
952439740 3:33313741-33313763 CTGAATAAGTTAAATGAGGCTGG - Intronic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953727060 3:45408664-45408686 CTGCAGAAGCTCAAACAGGCTGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
954362624 3:50130286-50130308 TTCAAGAGGCTGAAGAAGGCCGG - Intergenic
954444155 3:50537679-50537701 CTGAAGAGGCTCCAGCAGGCTGG - Intergenic
955028660 3:55195323-55195345 CTAAAGATGGTGATGGAGGCTGG + Intergenic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
958036383 3:88174435-88174457 ATCAAGAACTTGAAGGAGGCAGG + Intergenic
958797251 3:98718715-98718737 CTTTAGAAGCTGAAGAAGGCAGG + Intergenic
958911582 3:100000178-100000200 CTGAAGGATCAGAAGAAGGCAGG - Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960260876 3:115567063-115567085 ATGAAGGAGATGAAGGAGACTGG + Intergenic
960726029 3:120671084-120671106 CTGAAGAAACTGGAGGACGAAGG - Intronic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
962002928 3:131318009-131318031 GTGAAGAATCTGAAGAAAGCAGG - Intronic
962020793 3:131499487-131499509 CTGAAGAAACTGGCGGGGGCAGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
964668663 3:159201744-159201766 CTGAGGCAGGTGAATGAGGCAGG - Intronic
965784333 3:172320081-172320103 TGGAAGAATCTGAAAGAGGCCGG + Intronic
966002003 3:174960927-174960949 CTTAAGAGGCTGAAGCAGGAGGG + Intronic
966486442 3:180476313-180476335 CTGAAGATTATGAAGGTGGCTGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
966926983 3:184651036-184651058 CTGAAGAACCTCAAGCAGGATGG + Intronic
967263587 3:187670184-187670206 CTGCAGAAACTGACGGAGTCTGG + Exonic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
968984353 4:3867091-3867113 CTGCAGAGGCTGGAAGAGGCAGG - Intergenic
969033132 4:4229076-4229098 CTAAAGAATGTGCAGGAGGCTGG - Intergenic
969059310 4:4422455-4422477 CTCAAGAGGCTGACTGAGGCAGG + Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969584938 4:8086021-8086043 CTGAGAAAACTAAAGGAGGCTGG + Intronic
969748134 4:9089944-9089966 CTCAAGAGGCTGAAGCAGGAGGG + Intergenic
970232797 4:13928159-13928181 TGGAAGATGCTGAAGGAGCCTGG + Intergenic
970990950 4:22212494-22212516 CTGAAAAAGCTGGAGGAAGTGGG - Intergenic
972298954 4:37767152-37767174 CCAAAGAAGCTGAGGGTGGCAGG - Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972541632 4:40044019-40044041 CTGAAGATGATCAAAGAGGCGGG - Intergenic
972766217 4:42153731-42153753 CTGAGGAAGCTGCAGGAGAGAGG - Intergenic
973658343 4:53075214-53075236 GTGAAGAAGCTGCAGAAGACAGG - Intronic
973786504 4:54337448-54337470 CAGAAGGGGCTGGAGGAGGCAGG - Intergenic
974766489 4:66353973-66353995 CTGAAGGTGATGAAGAAGGCAGG - Intergenic
976230186 4:82834569-82834591 CTGAATAAGTTAAAGGAGGGTGG + Intronic
976607703 4:86997810-86997832 CCTAAGAAGCTGAGTGAGGCTGG + Intronic
977344607 4:95801769-95801791 CTGAGGAAGATAAAAGAGGCAGG - Intergenic
977731855 4:100363263-100363285 CAGAGGAAGCTGGAAGAGGCAGG - Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978215027 4:106189873-106189895 CTGAAACAGCTGAAGGAAGTTGG - Intronic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
980489550 4:133507047-133507069 TTGAAGTACCTGAAGGGGGCGGG + Intergenic
982297207 4:153841366-153841388 CTAAAGAATCTGAATTAGGCCGG - Intergenic
983145158 4:164204796-164204818 CTGATGAAGCTGAATAAGGCTGG - Intronic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984982325 4:185294446-185294468 ATGAAGATACTGAAGGAGTCAGG + Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985311072 4:188600007-188600029 GTGAAGAAGCTGAAGAAGAAAGG - Intergenic
985677749 5:1241016-1241038 GTGCAGAAGCTGGAAGAGGCGGG + Intronic
986788759 5:11140250-11140272 CTGGACAGGTTGAAGGAGGCAGG - Intronic
987534966 5:19173342-19173364 CTATGGAAGCTGAAGAAGGCTGG - Intergenic
988394261 5:30677614-30677636 CTGAGGAGGCTGAAGGGGGGAGG - Intergenic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
989708863 5:44372197-44372219 CACCAGAAGCTGAAAGAGGCAGG - Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
990372974 5:55139714-55139736 CTGATGAAACTGAATGAGGCAGG + Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
993606215 5:89993604-89993626 CTCAAGAACCTTAAGGATGCAGG - Intergenic
994702486 5:103153642-103153664 CTTAAGAAGCTGGGGGAGGGAGG - Intronic
996760756 5:126983860-126983882 ATGAAAAAGATGAAGGAAGCTGG - Intronic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
997518531 5:134507230-134507252 GGGAGGAAGCTGAAGGGGGCAGG + Intergenic
997540549 5:134658157-134658179 CTCGAGAGGCTGAATGAGGCAGG + Intronic
997823192 5:137084275-137084297 CTTAGCAAGCAGAAGGAGGCAGG - Intronic
997969995 5:138393203-138393225 GTGAAGAAGCTGAAGCAATCTGG + Exonic
998927288 5:147140676-147140698 TTGAACAGGCTGAAGGTGGCTGG + Intergenic
999249670 5:150175082-150175104 ACAAAGAAGCTGAAAGAGGCAGG - Intronic
999271448 5:150298508-150298530 CCACAGAAGCTGCAGGAGGCAGG - Exonic
999353209 5:150897610-150897632 CTGATGAGGCTGAAGGAGGAGGG - Intronic
999528054 5:152430157-152430179 CTCAAGCAGCTGAATGAGGCTGG - Intronic
1000010545 5:157227462-157227484 CTGAAGAAGCTCAATTAGGGAGG + Intronic
1000734807 5:164885949-164885971 CTGATGGAGCTGAAGGAAGTGGG - Intergenic
1000744992 5:165021380-165021402 CTAAAGAAGAGGAAGGAGACTGG + Intergenic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1002169391 5:177366877-177366899 CTGAGCTAGCTGAAGGAGGAGGG - Exonic
1002556362 5:180044925-180044947 CTTAAGAGACTGAAGGAGGGAGG + Intronic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1004000861 6:11595882-11595904 GTCAAAAAGCTGAGGGAGGCGGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004330583 6:14717024-14717046 CTGCAGCAGCTGAAGCAGCCAGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004927904 6:20433123-20433145 ATGAAGAACTTGAAGGAAGCTGG + Intronic
1005127991 6:22470774-22470796 CTGATAAAGCTAAAGGAAGCGGG - Intergenic
1005170773 6:22981832-22981854 CTGGAGTATCTGAAGGAGTCTGG + Intergenic
1005464119 6:26095191-26095213 ATGAAGAAAGTGAAGTAGGCCGG + Exonic
1005845017 6:29770264-29770286 ATTACAAAGCTGAAGGAGGCGGG + Intergenic
1005944564 6:30585950-30585972 CTGAAGGAGCTGAAGGCAGGCGG + Exonic
1006154709 6:32007919-32007941 CCGGAGATGCTGAAGGGGGCTGG - Intergenic
1006161021 6:32040654-32040676 CCGGAGATGCTGAAGGGGGCTGG - Exonic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007409700 6:41654576-41654598 CTGGAGAAGCTGAAGTCAGCAGG - Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008568195 6:52789864-52789886 CCCCAGAAGCTGTAGGAGGCAGG + Intergenic
1008882910 6:56399674-56399696 CTGAACAGGCTGAAGGCAGCTGG + Intergenic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010349438 6:74854793-74854815 CTGAGGGATCTGAAGGATGCAGG + Intergenic
1011013175 6:82724829-82724851 CTGGACAACCTCAAGGAGGCGGG + Intergenic
1011153093 6:84297373-84297395 CTGGAGAAGCTGAAGTAGTCTGG + Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011641187 6:89417864-89417886 CTGAAGAAGTTTAAGAAGGGAGG + Intergenic
1011866458 6:91834716-91834738 CACCAGAAGCTGAAAGAGGCAGG + Intergenic
1012966202 6:105676191-105676213 CAGGAGATGCTGAAGGAGACAGG + Intergenic
1013298836 6:108783812-108783834 CTGAAGGACCTGTAGGAGACAGG + Intergenic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016299464 6:142614227-142614249 ATAAAGAAGCTGCAGAAGGCAGG - Intergenic
1016454604 6:144217357-144217379 CGGAAGAAGCCGAAGGAGACAGG - Intergenic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017251562 6:152285570-152285592 CTGGAGTGGCTGAAGAAGGCTGG - Intronic
1018733188 6:166668675-166668697 CTGAAGAGGCACAGGGAGGCTGG + Intronic
1018796565 6:167190061-167190083 CTGAGGAAGAGCAAGGAGGCCGG + Intronic
1018819754 6:167365056-167365078 CTGAGGAAGAGCAAGGAGGCCGG - Intronic
1018870441 6:167778514-167778536 CAGAAGAGGCTGGAGCAGGCAGG - Intergenic
1018992349 6:168683853-168683875 CTGCAGCAGCTGAAGGCCGCAGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020117032 7:5481719-5481741 CTCGAGAAGCTGCAGGAGCCTGG - Exonic
1020592818 7:10164664-10164686 CTGAAGAATCTGAAGTAGGTGGG - Intergenic
1020634299 7:10677886-10677908 TTTAAGAAGCTGGAGGAAGCAGG + Intergenic
1021020804 7:15596206-15596228 CTGATGCAGCTGAAGGAGCAAGG - Intergenic
1021336290 7:19406774-19406796 CCCAAGCAGCTGAAGGAGGCTGG + Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1023218629 7:37894474-37894496 CTGAAGATAGTTAAGGAGGCTGG + Exonic
1023286569 7:38627245-38627267 GTAAAAATGCTGAAGGAGGCCGG + Intronic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024865378 7:53899943-53899965 TTGCAGAGGCTGCAGGAGGCAGG - Intergenic
1025607103 7:63047354-63047376 CTGAAGATGGTGAGGGAGGTTGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1028718399 7:94000892-94000914 CTTGGGAAGCTGAGGGAGGCAGG + Intronic
1028789299 7:94835188-94835210 CTGAGGAGGCTGAGGCAGGCAGG - Intergenic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029366576 7:100120198-100120220 CTGCAGAGGCTGCAGGAGCCGGG + Intronic
1030139393 7:106289451-106289473 AGGATGAAGCTGAAGGAGGTGGG + Intergenic
1030218203 7:107068258-107068280 CTAAAGAGGCTGGAGGGGGCAGG + Intronic
1030489249 7:110211428-110211450 CTGAAGGAGCTGAAAGAAACTGG - Intergenic
1030699373 7:112621832-112621854 ATTAAGAAGATGGAGGAGGCCGG + Intergenic
1031018285 7:116598696-116598718 CTCAAAAAGCCGAAGGTGGCTGG - Intergenic
1031923661 7:127619358-127619380 CTGAGGATGCTGGAGGAGGGTGG - Intergenic
1032335830 7:131023481-131023503 CTAATGAAGCTGAAGCAGGGTGG + Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032870172 7:135976952-135976974 CTGAGGAAGCTGATGGGAGCTGG - Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033628866 7:143138056-143138078 CTGAGCAAGCTGCAGGAGGTGGG + Intronic
1033879569 7:145863747-145863769 CTGGAGTAACTGAAGGAGACAGG + Intergenic
1034354015 7:150436476-150436498 CTAAAGATGTTGAAGGAGGTGGG + Intergenic
1034669532 7:152847602-152847624 ATGAAGTAGCTGAAGGAATCTGG + Intronic
1035050016 7:155993356-155993378 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035050049 7:155993536-155993558 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035323514 7:158049979-158050001 CTGAAGGAGTTGAAAGGGGCAGG + Intronic
1035766704 8:2112314-2112336 TTGAAGAGGCTGAAGTAGTCAGG + Intronic
1035768308 8:2126656-2126678 CGGGAGAGGCTGATGGAGGCTGG + Intronic
1035795413 8:2352006-2352028 CTGAAGAAGCTGAGGGCTCCAGG - Intergenic
1035998858 8:4579468-4579490 CTTAAGAGGCTAAGGGAGGCAGG - Intronic
1036474968 8:9084832-9084854 CTGAAGAAGCTGAAGTGGAGAGG + Intronic
1036777830 8:11625671-11625693 CTGAAGACGGTGAGGGAGGCTGG + Intergenic
1037155401 8:15693394-15693416 CTTATGAAGCTGAAGTTGGCTGG + Intronic
1038223460 8:25632545-25632567 CTGAGGAAGATGGAGAAGGCAGG + Intergenic
1038724664 8:30069893-30069915 CTGCAGAAACTGAAGGAGTCTGG - Exonic
1039244991 8:35598844-35598866 CTAAAAAAGCTGAAGTTGGCCGG + Intronic
1040684978 8:49860967-49860989 CAGATGAAGCTGAAAGATGCTGG + Intergenic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1041347313 8:56912955-56912977 CTGAAGAAAATGAAGCAGGCAGG - Intergenic
1041718988 8:60959454-60959476 CTGATGGAGCTGCAGGATGCTGG - Intergenic
1041943867 8:63420405-63420427 CTGAAGCAGTTCAAGGAGGGTGG + Intergenic
1042139721 8:65665729-65665751 CTCAGGAAGCTGAGGGAGGAGGG - Intronic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042732696 8:71954859-71954881 CTGAGGAAGCTAAAGCAGGAGGG - Intronic
1043532398 8:81165753-81165775 CTGAGCTAGCTGCAGGAGGCTGG + Intergenic
1044941767 8:97350807-97350829 CTGAAGCAGCTGAACGAAGTAGG + Intergenic
1045348415 8:101315924-101315946 CTCAAGAGGCTGAGTGAGGCAGG - Intergenic
1045775475 8:105797569-105797591 GAGAAGAGGCTGTAGGAGGCAGG - Intronic
1045938328 8:107709196-107709218 CTGAAGAACTTGAAGCAGGCTGG - Intergenic
1047887331 8:129266140-129266162 CTGAAGAAGCTGATGGCTGGAGG + Intergenic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051764993 9:20513738-20513760 CTGAGGAACCGGGAGGAGGCAGG + Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1053376346 9:37609828-37609850 CTGAGGAAGAGCAAGGAGGCTGG - Intronic
1053377596 9:37621156-37621178 CTGAGGAGGATAAAGGAGGCAGG + Intronic
1054912666 9:70468136-70468158 CTCAGGAAGCTGAATGAGGCAGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058730746 9:107847396-107847418 CTGAATAAGTTGGGGGAGGCTGG + Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1059906483 9:118992167-118992189 CTGAAGAAGCTCAGGGAGCAGGG + Intergenic
1060459200 9:123833015-123833037 CTCAGGAAGCTGAAGTAGGAGGG + Intronic
1061203505 9:129150328-129150350 CTGAAGAGGATGGAGGTGGCGGG + Intergenic
1061774912 9:132955586-132955608 TTTAAAAAGCTGAAAGAGGCTGG - Intronic
1061905111 9:133692694-133692716 CGGGAGGAGGTGAAGGAGGCCGG - Intronic
1062151264 9:135020375-135020397 CCATAGAAGCTGGAGGAGGCAGG + Intergenic
1062158617 9:135067621-135067643 CTCCAGAAGCTGCAGGAGGCAGG + Intergenic
1062206306 9:135339441-135339463 GAGAAGAAGCTCCAGGAGGCCGG + Intergenic
1062482509 9:136759164-136759186 CTGGGGGAGCTGCAGGAGGCCGG - Intergenic
1062643216 9:137532819-137532841 CTGGAGAAGGTGAAGCAAGCAGG + Intronic
1185782593 X:2862207-2862229 CTCCAGAAGCTGGAGAAGGCAGG + Intronic
1186492868 X:9988185-9988207 CTCAAGAAGCTGAGGGAGGAGGG + Intergenic
1186495091 X:10006749-10006771 CTGAAGCAGCAGCAGGAGCCTGG + Intergenic
1187203133 X:17155220-17155242 CTGTAGAATCTCAAGGTGGCAGG + Intergenic
1187333252 X:18359934-18359956 CAAAAGATGCTGAAGGAGCCAGG - Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187502043 X:19846993-19847015 CTGAATCAGCTGTAAGAGGCAGG + Intronic
1188401788 X:29754640-29754662 GTGACCAAGCTAAAGGAGGCTGG - Intronic
1188621240 X:32226725-32226747 CTGAAAAAGCTGAATGAGGTAGG - Intronic
1188676902 X:32952426-32952448 CTAAAGGAGCTGAACAAGGCTGG - Intronic
1188803303 X:34558046-34558068 CTGCAGAACCTCAAGGAAGCAGG + Intergenic
1188994927 X:36872472-36872494 CTTAAGAGGCTGAAGCAGGAGGG + Intergenic
1189340292 X:40199974-40199996 CGGAAGAAGGTGCAGGGGGCCGG - Intergenic
1190074876 X:47309657-47309679 CTCAAGAGGCTGAAGAAGGAGGG - Intergenic
1190282503 X:48940279-48940301 CGGGAGAGGCTGAAGGAAGCTGG + Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1190765576 X:53473172-53473194 CTGAAGAAAATGAAGCAGGGAGG + Intergenic
1190777899 X:53568806-53568828 CTGTAGAAGCTGGAGGTGGAGGG + Exonic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192362760 X:70449754-70449776 GTGGAGGCGCTGAAGGAGGCAGG + Exonic
1192948480 X:75990739-75990761 GTGAAAAAGCTGAAGGGGGCAGG + Intergenic
1194113932 X:89873117-89873139 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1194776846 X:97975882-97975904 CTGAAGAAGCTGAAGAACCAAGG - Intergenic
1195147326 X:102030554-102030576 TTGAAGTATCTGAAGGAGACAGG + Intergenic
1195464160 X:105161132-105161154 CTCAAGAAGCTGAAGCCGGAGGG + Intronic
1195574200 X:106431534-106431556 CTGAAGGGGCTGGAGGAGGAAGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1195723925 X:107894058-107894080 CTGAACCAGATGAGGGAGGCAGG - Intronic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1197029953 X:121801752-121801774 TTGAAGTACCTGAAGGAGACGGG - Intergenic
1197326758 X:125103876-125103898 CTCAAGAGGCTGAGTGAGGCAGG + Intergenic
1197634904 X:128903976-128903998 ATGAACAAGCTGAACTAGGCTGG - Intergenic
1198052847 X:132965135-132965157 CTGGAGAATTTGAAGGAAGCAGG + Intergenic
1198155451 X:133955413-133955435 AGGAGGGAGCTGAAGGAGGCCGG - Intronic
1198645928 X:138806512-138806534 CAGAAGAATCTGAAGGGGACAGG + Intronic
1198909900 X:141601729-141601751 CTGAAAAAGCTTAATTAGGCAGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199186336 X:144919875-144919897 CTGAAGATGGTGAACGGGGCAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199369746 X:147033647-147033669 CTCAAGAGGCTGAAGGGGGGAGG + Intergenic
1199600376 X:149538130-149538152 CTGGAGAAGCTCGAGGAAGCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200466671 Y:3528473-3528495 CTGAAGAGGCTGGACCAGGCAGG + Intergenic
1201979765 Y:19893679-19893701 CTCAAGAAGGTGAGAGAGGCTGG - Intergenic