ID: 1007326610

View in Genome Browser
Species Human (GRCh38)
Location 6:41066229-41066251
Sequence TAGAGGTTGAGGCGGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14843
Summary {0: 1, 1: 4, 2: 78, 3: 1312, 4: 13448}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007326610_1007326618 10 Left 1007326610 6:41066229-41066251 CCATCCTCCCGCCTCAACCTCTA 0: 1
1: 4
2: 78
3: 1312
4: 13448
Right 1007326618 6:41066262-41066284 AACTACAGGCCTGCACCACCAGG 0: 1
1: 13
2: 184
3: 901
4: 2352
1007326610_1007326617 -4 Left 1007326610 6:41066229-41066251 CCATCCTCCCGCCTCAACCTCTA 0: 1
1: 4
2: 78
3: 1312
4: 13448
Right 1007326617 6:41066248-41066270 TCTAGAGTAGCTGGAACTACAGG 0: 17
1: 724
2: 14942
3: 136752
4: 261265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007326610 Original CRISPR TAGAGGTTGAGGCGGGAGGA TGG (reversed) Exonic
Too many off-targets to display for this crispr