ID: 1007329530

View in Genome Browser
Species Human (GRCh38)
Location 6:41094328-41094350
Sequence TGTGCACTAGATAACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007329525_1007329530 24 Left 1007329525 6:41094281-41094303 CCTTGTGACTTTGATCCCAGCTG 0: 1
1: 0
2: 1
3: 31
4: 304
Right 1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1007329527_1007329530 9 Left 1007329527 6:41094296-41094318 CCCAGCTGTCTTAAACTTTGGAG 0: 1
1: 0
2: 0
3: 13
4: 130
Right 1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1007329528_1007329530 8 Left 1007329528 6:41094297-41094319 CCAGCTGTCTTAAACTTTGGAGA 0: 1
1: 0
2: 1
3: 8
4: 145
Right 1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 79
1007329524_1007329530 25 Left 1007329524 6:41094280-41094302 CCCTTGTGACTTTGATCCCAGCT 0: 1
1: 0
2: 0
3: 9
4: 194
Right 1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007329530 Original CRISPR TGTGCACTAGATAACTGTGC TGG Intronic
901159070 1:7161292-7161314 TGAGCAGGAGCTAACTGTGCAGG - Intronic
903864665 1:26389514-26389536 TGGGCACAAGGTAAGTGTGCAGG - Intergenic
908343040 1:63202582-63202604 TGAGCACAAGATAATAGTGCAGG - Intergenic
911094487 1:94044538-94044560 TGGGCTCTAGAGAAGTGTGCTGG + Intronic
914237621 1:145826489-145826511 TGTGCACTTGATAACTCACCAGG - Exonic
915290056 1:154877500-154877522 TTTTCACAAGACAACTGTGCAGG - Intergenic
1072036074 10:91563949-91563971 TGTGCAATAAATTACTGTGTAGG - Intergenic
1074015966 10:109534106-109534128 TGTGCAAAAGAGAACTGTTCTGG - Intergenic
1074617295 10:115081822-115081844 TCTGCACTAGATAATTATGGTGG - Intergenic
1076626552 10:131824629-131824651 TGTGCCCCAGAGACCTGTGCGGG + Intergenic
1080217512 11:29862103-29862125 TCTGCACAAGACAACTGTGCAGG - Intergenic
1082931908 11:58617405-58617427 AGTGCCCAAGATATCTGTGCTGG - Exonic
1085849713 11:80106060-80106082 TGTGCAATAGATAAATGTCAAGG - Intergenic
1091758732 12:3073255-3073277 GGAGCAGTAGTTAACTGTGCAGG + Intergenic
1106585719 13:31054677-31054699 TGTGCACAAGGAAACTGTGTGGG - Intergenic
1108561466 13:51648308-51648330 TTTGCACTAGATGTCTGTCCAGG + Intronic
1108716819 13:53088257-53088279 TCTTCACTAGAAAAATGTGCTGG + Intergenic
1111627249 13:90804815-90804837 TGTGCTCCACATAACTGTCCTGG - Intergenic
1111926516 13:94469033-94469055 TGTGAACTAGGAAACTTTGCCGG - Exonic
1112490584 13:99859595-99859617 GATGCACTAGAGAACTGTTCAGG - Intronic
1112985588 13:105445341-105445363 TGTGGATTAGAAAACTGTGAAGG - Intergenic
1118141846 14:63092517-63092539 TTTGCACTAGATGTCTGTGGAGG + Intronic
1118176100 14:63441509-63441531 TGTGCACTAAATATCTATGCTGG - Intronic
1127468632 15:59269871-59269893 TCTGCTCCAGATACCTGTGCAGG - Intronic
1128369013 15:67025779-67025801 TGTGCAGAAGATAAATGTTCAGG + Intergenic
1130890620 15:88130870-88130892 TGTACACTAGATAATAGTGATGG + Intronic
1131325019 15:91434565-91434587 TGTGCACTTGAAATATGTGCAGG + Intergenic
1138652332 16:58467876-58467898 AGTGCACTCCATCACTGTGCTGG + Intronic
1139558268 16:67726415-67726437 CTTGCACTAGCTGACTGTGCTGG - Exonic
1141350885 16:83295099-83295121 TGTGTTCTTGATAACTATGCTGG - Intronic
1144054439 17:11526517-11526539 TGTGCTCTACAAAGCTGTGCAGG - Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1149658750 17:58323863-58323885 TCTGCACTCAATAACTGTCCTGG + Intronic
1156045075 18:32868810-32868832 TTTGTACTAGTTAACTTTGCTGG - Intergenic
927218549 2:20684745-20684767 TGAGCACTCGGTAACTCTGCAGG + Intronic
934539444 2:95161817-95161839 GGTGCACTAGAGCACTGAGCAGG - Intronic
934761463 2:96859214-96859236 TGTGCACCAGACCACTGTCCTGG - Intergenic
937401970 2:121592029-121592051 TGTTCAATAGATAACTTGGCAGG + Intronic
937892194 2:126947240-126947262 TGTGCCTAAGTTAACTGTGCAGG + Intergenic
941675412 2:168338681-168338703 TATGCATTAGATGGCTGTGCAGG + Intergenic
943176961 2:184488805-184488827 TGTTCACTAGATGAATGTGCAGG + Intergenic
944752411 2:202723755-202723777 TGTGCATTTGGTATCTGTGCAGG + Intronic
944949521 2:204731594-204731616 TGTTCAGTAGAGAACTATGCTGG + Intronic
946472500 2:219975268-219975290 TGTGAACCAGAAAACTGTGTAGG - Intergenic
946587519 2:221207040-221207062 TGTGGACTAGAAAAATGTGAAGG + Intergenic
946595667 2:221303241-221303263 TGTGTATCAGATAACTGTTCGGG - Intergenic
1168991629 20:2101517-2101539 TTTGCACAAGATCACTGGGCTGG + Intergenic
1176181045 20:63749704-63749726 TGTGCACCAGGTTACTGTGCTGG - Intronic
1178602992 21:34011182-34011204 TTTGCACTAGATAAGTCTGACGG - Intergenic
1182795092 22:32986103-32986125 TGTGCCCTAGCTCATTGTGCTGG - Intronic
950031811 3:9858737-9858759 TGTGCCCTAGAAAGCTGTGAAGG + Intergenic
964668941 3:159204201-159204223 TGTGCACTGGAAAACTGGGCAGG + Intronic
970622530 4:17838773-17838795 TGTGCAATGGATAATTATGCAGG + Intronic
975739947 4:77420083-77420105 TGTGCAATAGAAAACTCTACAGG + Intronic
980964453 4:139507213-139507235 TGTGCTCCAGATAACTGCACCGG + Exonic
983289554 4:165784822-165784844 TGTGCATTTGATAGCTGAGCAGG - Intergenic
984577378 4:181466660-181466682 TGTAAACTAGATAACTGTAGAGG - Intergenic
985127164 4:186706104-186706126 TCTGCACTGGGTAACTTTGCCGG + Intronic
986173102 5:5329559-5329581 TGTGCTCGAGATAACTGAGATGG - Intergenic
987836028 5:23163211-23163233 TGTTCACTACATAAATGTGTAGG - Intergenic
992143358 5:73820919-73820941 TCTGCAGTAGATCACTTTGCAGG - Intronic
996373453 5:122776745-122776767 TGTGAACTAGAATACTGTGAAGG + Intronic
998912301 5:146973236-146973258 TGTGCAATAGATAATTTTGCCGG + Intronic
999207423 5:149859576-149859598 TGAGCATGGGATAACTGTGCAGG - Exonic
1000974760 5:167752520-167752542 AGTGCACTAGTTAGCTGTGATGG + Intronic
1006560917 6:34911438-34911460 TGTGCACAGGATAACAGTGGGGG + Intronic
1007308863 6:40929102-40929124 TGTGCACTAGAAAAATCTGGTGG - Intergenic
1007329530 6:41094328-41094350 TGTGCACTAGATAACTGTGCTGG + Intronic
1014983086 6:127967962-127967984 TGTGCTCATGATAACTTTGCTGG + Intergenic
1020082566 7:5294777-5294799 AATGCACTAGAGAACTGTGTTGG - Intronic
1031015984 7:116577141-116577163 TGCCCACTTAATAACTGTGCAGG + Intergenic
1032561839 7:132900533-132900555 TGAGCACTAGATGAAAGTGCTGG - Intronic
1035743267 8:1944647-1944669 TTTACTTTAGATAACTGTGCAGG + Intronic
1038455065 8:27667564-27667586 CGTGCTCAAGATAACAGTGCTGG - Intronic
1040543220 8:48377905-48377927 TATGCACAAGATGACTCTGCAGG - Intergenic
1043261263 8:78201473-78201495 TGCTCACTAGGTAACTGTGTAGG - Intergenic
1043428061 8:80168564-80168586 TGTTCACTAGCAAACTGTGTTGG - Intronic
1051344321 9:16138831-16138853 TGTGCACTGGAGGACTGGGCTGG + Intergenic
1053092883 9:35295805-35295827 TGTGCACCAGTTCCCTGTGCCGG + Exonic
1057721877 9:97538489-97538511 TGTGCACAGGATAAATTTGCTGG - Intronic
1060337900 9:122743924-122743946 TGTGCAGTAGAGAACTAAGCTGG - Intergenic
1188635159 X:32420877-32420899 TGTGCATTAGAGATCTCTGCTGG + Intronic
1189956867 X:46284590-46284612 TGTACAGTAACTAACTGTGCTGG + Intergenic
1196109757 X:111933359-111933381 TGCCCACTAGACAACTGTACAGG + Intronic
1198071224 X:133150467-133150489 TCTTCACATGATAACTGTGCAGG - Intergenic
1199916560 X:152348105-152348127 TGTGCACTAAATTATTGTGTGGG + Intronic