ID: 1007330164

View in Genome Browser
Species Human (GRCh38)
Location 6:41100856-41100878
Sequence CTAAGAATGTGGGAAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007330152_1007330164 4 Left 1007330152 6:41100829-41100851 CCCTTCTCCCCGGGGAAGTAGGC No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330153_1007330164 3 Left 1007330153 6:41100830-41100852 CCTTCTCCCCGGGGAAGTAGGCC No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330154_1007330164 -3 Left 1007330154 6:41100836-41100858 CCCCGGGGAAGTAGGCCCCGCTA No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330143_1007330164 20 Left 1007330143 6:41100813-41100835 CCGCCGCACCTCCAGCCCCTTCT No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330144_1007330164 17 Left 1007330144 6:41100816-41100838 CCGCACCTCCAGCCCCTTCTCCC No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330155_1007330164 -4 Left 1007330155 6:41100837-41100859 CCCGGGGAAGTAGGCCCCGCTAA No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330156_1007330164 -5 Left 1007330156 6:41100838-41100860 CCGGGGAAGTAGGCCCCGCTAAG No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330149_1007330164 9 Left 1007330149 6:41100824-41100846 CCAGCCCCTTCTCCCCGGGGAAG No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330147_1007330164 12 Left 1007330147 6:41100821-41100843 CCTCCAGCCCCTTCTCCCCGGGG No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data
1007330150_1007330164 5 Left 1007330150 6:41100828-41100850 CCCCTTCTCCCCGGGGAAGTAGG No data
Right 1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007330164 Original CRISPR CTAAGAATGTGGGAAGGTGG TGG Intergenic
No off target data available for this crispr