ID: 1007339525

View in Genome Browser
Species Human (GRCh38)
Location 6:41181730-41181752
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007339521_1007339525 1 Left 1007339521 6:41181706-41181728 CCATAGGGAAGGAAGGTCCTCAC No data
Right 1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007339525 Original CRISPR ACACCCTGCCTGGCAAAGAC AGG Intergenic