ID: 1007340155

View in Genome Browser
Species Human (GRCh38)
Location 6:41186169-41186191
Sequence CAGGAGGCCTGGAAGGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007340141_1007340155 27 Left 1007340141 6:41186119-41186141 CCGGCCCTGGGGATGAATTGCTG No data
Right 1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG No data
1007340143_1007340155 23 Left 1007340143 6:41186123-41186145 CCCTGGGGATGAATTGCTGAGGA No data
Right 1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG No data
1007340144_1007340155 22 Left 1007340144 6:41186124-41186146 CCTGGGGATGAATTGCTGAGGAA No data
Right 1007340155 6:41186169-41186191 CAGGAGGCCTGGAAGGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007340155 Original CRISPR CAGGAGGCCTGGAAGGAAGG GGG Intergenic
No off target data available for this crispr