ID: 1007344035

View in Genome Browser
Species Human (GRCh38)
Location 6:41214876-41214898
Sequence TGTCATTCCCCTAGTGGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007344029_1007344035 3 Left 1007344029 6:41214850-41214872 CCTGATGGTGGTAGCCCCTACTG No data
Right 1007344035 6:41214876-41214898 TGTCATTCCCCTAGTGGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007344035 Original CRISPR TGTCATTCCCCTAGTGGCTA GGG Intergenic
No off target data available for this crispr