ID: 1007345106

View in Genome Browser
Species Human (GRCh38)
Location 6:41223223-41223245
Sequence GTCCTCAGAAATCACAGTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007345096_1007345106 8 Left 1007345096 6:41223192-41223214 CCCCCAACCCCAAGAGGGAGACA No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345098_1007345106 6 Left 1007345098 6:41223194-41223216 CCCAACCCCAAGAGGGAGACATG No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345092_1007345106 28 Left 1007345092 6:41223172-41223194 CCCTGAGCTCACTGCTTAGTCCC No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345097_1007345106 7 Left 1007345097 6:41223193-41223215 CCCCAACCCCAAGAGGGAGACAT No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345103_1007345106 0 Left 1007345103 6:41223200-41223222 CCCAAGAGGGAGACATGAGGGTG No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345093_1007345106 27 Left 1007345093 6:41223173-41223195 CCTGAGCTCACTGCTTAGTCCCC No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345102_1007345106 1 Left 1007345102 6:41223199-41223221 CCCCAAGAGGGAGACATGAGGGT No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345099_1007345106 5 Left 1007345099 6:41223195-41223217 CCAACCCCAAGAGGGAGACATGA No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data
1007345104_1007345106 -1 Left 1007345104 6:41223201-41223223 CCAAGAGGGAGACATGAGGGTGG No data
Right 1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007345106 Original CRISPR GTCCTCAGAAATCACAGTGA CGG Intergenic
No off target data available for this crispr