ID: 1007345637

View in Genome Browser
Species Human (GRCh38)
Location 6:41227846-41227868
Sequence AGATGTTCCCTGGAAATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007345637_1007345642 -10 Left 1007345637 6:41227846-41227868 CCCACCATTTCCAGGGAACATCT No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345637_1007345644 22 Left 1007345637 6:41227846-41227868 CCCACCATTTCCAGGGAACATCT No data
Right 1007345644 6:41227891-41227913 TGCCCTCTACAAAATGTCTCAGG No data
1007345637_1007345645 23 Left 1007345637 6:41227846-41227868 CCCACCATTTCCAGGGAACATCT No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007345637 Original CRISPR AGATGTTCCCTGGAAATGGT GGG (reversed) Intergenic
No off target data available for this crispr