ID: 1007345642

View in Genome Browser
Species Human (GRCh38)
Location 6:41227859-41227881
Sequence GGGAACATCTTGTAATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007345632_1007345642 4 Left 1007345632 6:41227832-41227854 CCTGCTTTCCTGGCCCCACCATT No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345626_1007345642 28 Left 1007345626 6:41227808-41227830 CCCTGACCAGCACTCTCTTTCCT No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345628_1007345642 22 Left 1007345628 6:41227814-41227836 CCAGCACTCTCTTTCCTCCCTGC No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345630_1007345642 8 Left 1007345630 6:41227828-41227850 CCTCCCTGCTTTCCTGGCCCCAC No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345636_1007345642 -9 Left 1007345636 6:41227845-41227867 CCCCACCATTTCCAGGGAACATC No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345635_1007345642 -4 Left 1007345635 6:41227840-41227862 CCTGGCCCCACCATTTCCAGGGA No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345631_1007345642 5 Left 1007345631 6:41227831-41227853 CCCTGCTTTCCTGGCCCCACCAT No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345637_1007345642 -10 Left 1007345637 6:41227846-41227868 CCCACCATTTCCAGGGAACATCT No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data
1007345627_1007345642 27 Left 1007345627 6:41227809-41227831 CCTGACCAGCACTCTCTTTCCTC No data
Right 1007345642 6:41227859-41227881 GGGAACATCTTGTAATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007345642 Original CRISPR GGGAACATCTTGTAATTCCT GGG Intergenic
No off target data available for this crispr