ID: 1007345645

View in Genome Browser
Species Human (GRCh38)
Location 6:41227892-41227914
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007345638_1007345645 22 Left 1007345638 6:41227847-41227869 CCACCATTTCCAGGGAACATCTT No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345635_1007345645 29 Left 1007345635 6:41227840-41227862 CCTGGCCCCACCATTTCCAGGGA No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345640_1007345645 13 Left 1007345640 6:41227856-41227878 CCAGGGAACATCTTGTAATTCCT No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345636_1007345645 24 Left 1007345636 6:41227845-41227867 CCCCACCATTTCCAGGGAACATC No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345637_1007345645 23 Left 1007345637 6:41227846-41227868 CCCACCATTTCCAGGGAACATCT No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345639_1007345645 19 Left 1007345639 6:41227850-41227872 CCATTTCCAGGGAACATCTTGTA No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data
1007345643_1007345645 -7 Left 1007345643 6:41227876-41227898 CCTGGGATTAAAATCTGCCCTCT No data
Right 1007345645 6:41227892-41227914 GCCCTCTACAAAATGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007345645 Original CRISPR GCCCTCTACAAAATGTCTCA GGG Intergenic
No off target data available for this crispr