ID: 1007350635

View in Genome Browser
Species Human (GRCh38)
Location 6:41271121-41271143
Sequence AGTGCCAGCTACAACTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007350635_1007350641 27 Left 1007350635 6:41271121-41271143 CCTGAACAGTTGTAGCTGGCACT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1007350635_1007350638 11 Left 1007350635 6:41271121-41271143 CCTGAACAGTTGTAGCTGGCACT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1007350638 6:41271155-41271177 CCTCTTCACCCTAAATATCACGG 0: 1
1: 0
2: 2
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007350635 Original CRISPR AGTGCCAGCTACAACTGTTC AGG (reversed) Intronic
901924439 1:12556972-12556994 AATGCCAGCTCCCACTGCTCCGG + Intergenic
902511640 1:16969909-16969931 AGGGCCAGCTACAACAGCTACGG + Exonic
906918990 1:50043112-50043134 AGTGCAAACGACAACTGTTAAGG + Intergenic
907328143 1:53654114-53654136 AGTGCCAGGCTCAACTGTGCAGG - Intronic
908373831 1:63512780-63512802 ATTGCCAGCTACAACTTCACAGG + Intronic
909133013 1:71763305-71763327 AAAGCCAGTTACTACTGTTCAGG - Intronic
911278456 1:95893785-95893807 AGTCCCAGTTACTACTGTGCTGG + Intergenic
911285588 1:95988219-95988241 AGTGACAGCTCCAACTGCACGGG - Intergenic
912981802 1:114380738-114380760 AGTTCCAACTACAGCAGTTCAGG + Intergenic
918871874 1:189985197-189985219 AGTCCCAGCTACTACTACTCGGG - Intergenic
921391967 1:214625337-214625359 AGTCCCAGCTACTCCTATTCAGG - Intronic
1062784619 10:252458-252480 AGGGCCAGCTTCATCTTTTCCGG - Exonic
1065784873 10:29203820-29203842 AGTGACAACTCCAACTCTTCAGG - Intergenic
1070104431 10:73417755-73417777 GGTGGCAGCTACTAATGTTCAGG - Intergenic
1081050714 11:38337161-38337183 AGTCCCAGCTACAGCTACTCGGG + Intergenic
1092265978 12:6980864-6980886 AGTGCCTGTTACAACAGTCCAGG + Intronic
1092763710 12:11833106-11833128 AGTGCTAGCTATATATGTTCAGG + Intronic
1098654070 12:73006844-73006866 AGTGGCAGATACCACTTTTCTGG - Intergenic
1099850417 12:88088885-88088907 ACTGCCAGCTACAACTACTCAGG + Intronic
1100470368 12:94887412-94887434 AGTCCCAGCTACAGCTACTCAGG - Intergenic
1101084277 12:101219665-101219687 AGGGCCAGCAACCACTTTTCTGG - Intergenic
1102944988 12:116978925-116978947 AGTCCCAACTAAAACTGTCCCGG - Intronic
1104035074 12:125092273-125092295 GGTGCCAGCTGCCTCTGTTCTGG + Intronic
1105902760 13:24771271-24771293 AGTCCCAGCTACTACTGGACTGG - Intronic
1107848320 13:44543556-44543578 ACTGCCAGCTAGGACTGTTTTGG - Intronic
1112524621 13:100132896-100132918 AATGCCAGCTACAGCTACTCAGG - Intronic
1114500212 14:23162982-23163004 AGTGCTAGCTACTGCTGTTTTGG - Intronic
1118877790 14:69799011-69799033 GCTGCCAGGTACACCTGTTCAGG + Intergenic
1119729458 14:76941849-76941871 AGTGGCAGCTGCTGCTGTTCTGG + Intergenic
1126589348 15:50323745-50323767 AGTCCCAGCTACAGCTACTCAGG + Intronic
1127270666 15:57398561-57398583 AGTGCCAGCGTCTACTTTTCTGG - Intronic
1129497036 15:75993572-75993594 AGTCCCAGCTACAGCTACTCAGG + Intronic
1143233258 17:5375578-5375600 AGTCCCAGCTACAACTACTTGGG + Intronic
1143517754 17:7428450-7428472 AGTCCCAGCTACAACTATTTGGG + Intergenic
1150197829 17:63319467-63319489 AGTCCCAGCTACAGCTACTCAGG - Intronic
1162309707 19:9898822-9898844 CATTCCAGCTACCACTGTTCTGG + Intronic
1163002999 19:14380758-14380780 AGTCCCAGCTACTACTACTCAGG - Intronic
1164608562 19:29617230-29617252 AGTGGTACCTACAACTTTTCTGG - Intronic
1166030313 19:40120445-40120467 CATGCCAGCTAAAACTGGTCAGG + Intergenic
1167007615 19:46786329-46786351 AGTGTGAGCTACAGCTGTTTTGG + Intronic
1167055336 19:47107428-47107450 GGAGCCAGATAAAACTGTTCAGG - Intronic
925932663 2:8722543-8722565 AGTTCCTGTTACCACTGTTCTGG + Intergenic
927087292 2:19685009-19685031 AGTCCCAGCTACAGCTACTCAGG - Intergenic
928018844 2:27684742-27684764 AGTGCCAGCTACAGGAATTCTGG - Intronic
928922571 2:36540772-36540794 AGTGCCTGTTACAGCTGTCCTGG - Intronic
929755137 2:44758001-44758023 AGGGCCTGCTACAGGTGTTCAGG - Intronic
935676918 2:105602386-105602408 AGTCCCAGCTACAGCTACTCAGG + Intergenic
943684317 2:190801683-190801705 AGTGCCAGCTACATTTCCTCCGG + Intergenic
1170126093 20:12965734-12965756 AGTGTCAGCTACATTTGTGCAGG + Intergenic
1170491942 20:16886281-16886303 AGTGGCAACTACGACTGTGCTGG - Intergenic
1170829324 20:19825951-19825973 AGTTCCAGCTAAAAATCTTCAGG - Intergenic
1172539226 20:35698480-35698502 TGTGCAAGCTACAACTCCTCTGG - Exonic
1172955555 20:38755655-38755677 AGTTCCAGCAACAACTGATTAGG - Intronic
1174945121 20:54976633-54976655 AGTCCCAGCTACAGCTACTCGGG - Intergenic
1175796823 20:61776459-61776481 AGTGGCAGCTTCTCCTGTTCTGG + Intronic
1178787880 21:35671316-35671338 AGTCCCAGCTACAGCTACTCGGG - Intronic
1181433846 22:22899060-22899082 AGTGCCAGTCACATCTGTTAGGG - Intergenic
960972717 3:123151077-123151099 AGGGCCAGCTACAACTGAGCAGG - Intronic
961248958 3:125483217-125483239 AGAGCCAGTTACAACTGAGCTGG + Intronic
964183095 3:153911563-153911585 AGTGCCAGTTACCAGTGTGCTGG + Intergenic
965012668 3:163114979-163115001 ACTGCCAGCTATAATTTTTCTGG + Intergenic
965936371 3:174118139-174118161 ATTGCCACTTACAACTGCTCAGG + Intronic
972475625 4:39446818-39446840 AGTGACATCTACAACCGCTCTGG + Exonic
975362895 4:73492522-73492544 TATGCCATCTACAACTGTTAAGG + Intronic
978196668 4:105980081-105980103 AATGCCAGCTCCAACTGATTAGG - Intronic
981163099 4:141522349-141522371 AGTGTTAGCTACTCCTGTTCTGG - Intergenic
981552276 4:145954123-145954145 AGTGCCAGGTATGACCGTTCTGG + Intergenic
987119873 5:14756916-14756938 AGTACCAATTACAAATGTTCTGG + Intronic
989421104 5:41240699-41240721 AGTGCCAGCTGCAGGTTTTCTGG + Intronic
992880988 5:81109700-81109722 GGTGCCAGCAACAACTGATCAGG - Intronic
996698523 5:126424721-126424743 AGTGCCAGCTACTATTATTTAGG - Intronic
997031182 5:130130666-130130688 AGAACCAGCTACAACAGCTCAGG - Intronic
1000652200 5:163831392-163831414 AGCTCAAGCTACAGCTGTTCAGG + Intergenic
1005739996 6:28782279-28782301 AGTCCCAGCTACACCTACTCAGG + Intergenic
1006817263 6:36860335-36860357 AGTCCCAGCTACAGCTACTCAGG + Intronic
1007350635 6:41271121-41271143 AGTGCCAGCTACAACTGTTCAGG - Intronic
1009033825 6:58092919-58092941 AGTAGCAGCTCCTACTGTTCTGG - Intergenic
1009209433 6:60844626-60844648 AGTAGCAGCTCCTACTGTTCTGG - Intergenic
1011960233 6:93079537-93079559 AATGCCAACTACTACTCTTCTGG + Intergenic
1013371298 6:109473123-109473145 AGTGCACCCTACAACTGTTGAGG + Intronic
1016909744 6:149186156-149186178 AGTGGCTGCTACAACTCTTTCGG + Intergenic
1022215693 7:28258720-28258742 TGAGCCTGCCACAACTGTTCAGG + Intergenic
1026607852 7:71830980-71831002 ATTGGCAGCTGCAGCTGTTCCGG + Intronic
1029103211 7:98151776-98151798 AGTGCCACCTTCACCTGATCCGG - Intronic
1030029275 7:105353976-105353998 TGTGACAGCCACAACTGCTCAGG - Intronic
1030353254 7:108514495-108514517 AGAGCCTGCTAAAACTGATCAGG - Exonic
1037381215 8:18287169-18287191 AGTCACAGAAACAACTGTTCAGG + Intergenic
1045810133 8:106211499-106211521 TGTGCCAACTACAATTGTTCTGG + Intergenic
1048176361 8:132156037-132156059 AGTACCAGCTGCAAATGTCCTGG - Intronic
1057080037 9:92167243-92167265 AGTTCCAGCTACATCTACTCAGG + Intergenic
1058958113 9:109968158-109968180 AGTGCCAGAGAGGACTGTTCTGG - Intronic
1059148234 9:111921524-111921546 AGTCCCAGCTACTCCTGTTTGGG + Intronic
1190954402 X:55178372-55178394 AGTGCCAGCTTCTACTATTGAGG + Intronic
1197724928 X:129769850-129769872 GGTGCCAGCCCCAACTTTTCTGG - Intergenic
1200786299 Y:7263666-7263688 AGTGCCATCAACAACAGTACTGG - Intergenic
1201505347 Y:14693268-14693290 ATTGCCAGCAACCACAGTTCAGG - Intronic