ID: 1007350636

View in Genome Browser
Species Human (GRCh38)
Location 6:41271152-41271174
Sequence TGATATTTAGGGTGAAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007350636_1007350641 -4 Left 1007350636 6:41271152-41271174 CCTCCTCTTCACCCTAAATATCA 0: 1
1: 0
2: 1
3: 25
4: 240
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007350636 Original CRISPR TGATATTTAGGGTGAAGAGG AGG (reversed) Intronic
903077273 1:20781207-20781229 TGAGATTTTTGGGGAAGAGGGGG - Intronic
903670135 1:25030684-25030706 TGAAATTTAGGGAGGGGAGGAGG + Intergenic
905033143 1:34900875-34900897 TGACAATGAGGGGGAAGAGGAGG + Intronic
905321081 1:37117813-37117835 GGTCATTTAGGGTGAAGAAGTGG - Intergenic
906992115 1:50750541-50750563 TAATCTTTAGGGTGAGAAGGAGG - Intronic
907409623 1:54274955-54274977 TGACATTTGGGCTGAGGAGGAGG - Intronic
907560966 1:55387098-55387120 TGATGATGATGGTGAAGAGGAGG - Intergenic
907809323 1:57852566-57852588 TGAGATGTGGGGTGATGAGGAGG - Intronic
908826366 1:68136371-68136393 TGACATTTATTGTGTAGAGGTGG - Intronic
910976268 1:92909443-92909465 TCATATCTGGGGTCAAGAGGAGG + Intronic
911404123 1:97414862-97414884 TGTTATTTAGGATGAATAGATGG - Intronic
911968652 1:104400897-104400919 TGATATTTAGGGAGAAAAAATGG + Intergenic
914864053 1:151410889-151410911 TGATATTTATGATGTAGAGATGG - Intronic
917294302 1:173503008-173503030 TGATATTTAGGTCAAAGAGTAGG - Intronic
920830307 1:209458700-209458722 TTATATTTAAGATAAAGAGGGGG + Intergenic
923146431 1:231201992-231202014 TGAGATTTGAGGTGAGGAGGAGG + Intronic
924060947 1:240173638-240173660 TGATATTTAAGTTGAAGAGTTGG + Intronic
924295526 1:242583467-242583489 TGAATTTTAGGGTGAAGTAGAGG + Intergenic
924612972 1:245589131-245589153 GGATCTTTTGGGTCAAGAGGTGG - Intronic
1062794360 10:332389-332411 TCTTATTTATGGTGATGAGGAGG - Intronic
1063164816 10:3451683-3451705 TGGTATTTAGAGGAAAGAGGAGG - Intergenic
1063458253 10:6200373-6200395 GGACATTTGGGGTGAAGATGGGG + Intronic
1063614518 10:7590287-7590309 GGATATTTAGGGAGAGGAGTTGG - Intronic
1064800803 10:19069095-19069117 TGATATTAAAGGTGAAAAAGGGG + Intronic
1066249165 10:33616209-33616231 AGATAGTTTGGGGGAAGAGGAGG - Intergenic
1068919573 10:62468538-62468560 TCAAATTTAGGGTGAAGCTGGGG + Intronic
1070374827 10:75819401-75819423 TGAAATTTGGGGAGTAGAGGAGG + Intronic
1072835531 10:98707595-98707617 TGAGATATAGGGTGCAGATGTGG - Intronic
1073052881 10:100680703-100680725 TGAGATTTAGGTTAAAGAGCTGG - Intergenic
1073110050 10:101057077-101057099 GGTTATCTAGGGAGAAGAGGAGG + Intergenic
1073558410 10:104476024-104476046 TCAGATGGAGGGTGAAGAGGGGG + Intergenic
1073642219 10:105264234-105264256 TGATATGAAAGGTGAAGAAGAGG + Exonic
1073997036 10:109327386-109327408 TTGTATTTAGGGAGAGGAGGAGG - Intergenic
1074047004 10:109848408-109848430 CCATATTTAGGGAGAAAAGGTGG - Intergenic
1075867295 10:125735742-125735764 TGAAAGTTATAGTGAAGAGGAGG + Exonic
1077201786 11:1311213-1311235 TGATTTTTAGCGTGAAAATGAGG - Intergenic
1077817833 11:5704870-5704892 TGGTAATAAGGGTGAAGAGGTGG + Intronic
1079507728 11:21172822-21172844 AGATATTTTGGGTAAAGAAGTGG + Intronic
1082929352 11:58583472-58583494 GGATAGTGAGGATGAAGAGGTGG + Intronic
1083050925 11:59775867-59775889 TTATATTTAGAGTGGAGAAGAGG + Intronic
1085496486 11:76974548-76974570 GGATCCTTAGGGTGAAGAAGTGG + Intronic
1085881961 11:80478053-80478075 TCATATGCAGGGTGAAGAAGAGG - Intergenic
1086116260 11:83254335-83254357 GAAAATTTAGGGGGAAGAGGTGG - Intronic
1086949094 11:92872982-92873004 TGATGTTTAGGCTGAAGACTGGG - Intronic
1088749973 11:112835191-112835213 TGATATGAAGGAAGAAGAGGGGG - Intergenic
1089837152 11:121380999-121381021 ATAAATTTAGGGTAAAGAGGTGG + Intergenic
1091004006 11:131935562-131935584 AGATAATTAGGGTTAAGAGAAGG + Intronic
1092870396 12:12800929-12800951 TGACATTTAGGGTGGGGAGTGGG + Intronic
1093109580 12:15133248-15133270 TAAGATTTAGGGGGAAGAGAGGG - Intronic
1093985363 12:25525491-25525513 TGATATTTAGCCTGAAGAGTGGG - Intronic
1095041189 12:37442698-37442720 TGATATTTAGGGTGTATATTTGG - Intergenic
1095154639 12:38837565-38837587 TAATATTTAGGGATAAGAGGAGG + Intronic
1095440307 12:42232902-42232924 TTATGTGTAGGCTGAAGAGGTGG - Intronic
1096179921 12:49544992-49545014 TGACATTTTGGGTGCAGAGGTGG - Intronic
1097456412 12:59803959-59803981 TGATATTTACTGTGAAGACCTGG + Intergenic
1101685801 12:107019160-107019182 TGATGGTTAGGGTGAAGGTGGGG + Intronic
1105054460 12:133084686-133084708 TGATTTTTAGAGAGAAAAGGAGG + Intronic
1105770117 13:23601709-23601731 TGATACAAAGGGTGAGGAGGAGG + Intronic
1107055186 13:36095643-36095665 TCATATTTTGGGGGAAGGGGTGG - Intronic
1107120631 13:36791672-36791694 TGAAATCTAGGATGCAGAGGTGG - Intergenic
1108161289 13:47642576-47642598 TGTTTTTTAGGATGGAGAGGTGG - Intergenic
1109090778 13:58042009-58042031 TGATATTAAGGGAGAGGAGATGG + Intergenic
1109257914 13:60106076-60106098 TGATATTTTTGGTATAGAGGTGG - Intronic
1110784190 13:79503754-79503776 TGATATTGTGGGTGGAGAGCTGG + Intronic
1113598239 13:111549180-111549202 TGATATTTAGGGAGTAAACGAGG - Intergenic
1114233075 14:20801424-20801446 TGATTTTGGGGGTGAAGAGTGGG - Exonic
1115380358 14:32730544-32730566 TTAAAGTTGGGGTGAAGAGGGGG + Intronic
1115738924 14:36366558-36366580 TCCTCTTTGGGGTGAAGAGGGGG - Intergenic
1116360228 14:43985152-43985174 TTATATTTAGGGAGCAGTGGAGG + Intergenic
1116793394 14:49363886-49363908 TGAGATTTAGGGGGAGGATGGGG - Intergenic
1119623197 14:76148507-76148529 AGCTATTTAGGGTGCTGAGGTGG + Intergenic
1123149960 14:106171126-106171148 TAATATTGAGGGTGATGAGAAGG + Intergenic
1123196256 14:106619289-106619311 TAATATTGAGGGTGATGAGAAGG + Intergenic
1123209169 14:106741940-106741962 TAATATTGAGGGTGATGAGAAGG + Intergenic
1126293594 15:47111012-47111034 TGATATTTAGGGTGTATATTTGG + Intergenic
1128138109 15:65278943-65278965 TGAAATGAAGGCTGAAGAGGTGG + Intronic
1128138170 15:65279441-65279463 TGATATGGAGGGTGAAGGGGTGG - Intronic
1131629264 15:94158732-94158754 TGATATTTTTGGTAAAGATGGGG + Intergenic
1133999975 16:10775336-10775358 TGATATTTGGAGTCAAGTGGCGG - Intronic
1134380158 16:13716773-13716795 TGTTATTTAGGTTGACAAGGGGG + Intergenic
1134600494 16:15529783-15529805 TGATGGTTAGGGTGAACAGTGGG + Intronic
1135510544 16:23079300-23079322 TGAAATTTAGAGTCTAGAGGTGG - Intronic
1135956442 16:26960174-26960196 TGAGATTTTGAGTGATGAGGGGG - Intergenic
1136680094 16:31955665-31955687 TAATATTGAGGGTGATGAGAAGG - Intergenic
1136780439 16:32897209-32897231 TAATATTGAGGGTGATGAGAGGG - Intergenic
1136871981 16:33816011-33816033 TAATATTGAGGGTGATGAGAAGG - Intergenic
1136889971 16:33962439-33962461 TAATATTGAGGGTGATGAGAAGG + Intergenic
1139079183 16:63493574-63493596 GGATAATTGGAGTGAAGAGGAGG - Intergenic
1142372052 16:89688007-89688029 TGATACTGAGGGTTAAGAGAAGG + Intronic
1203083063 16_KI270728v1_random:1161175-1161197 TAATATTGAGGGTGATGAGAAGG - Intergenic
1203100191 16_KI270728v1_random:1300057-1300079 TAATATTGAGGGTGATGAGAAGG + Intergenic
1142770013 17:2089853-2089875 GGGTATTTAAGGTGGAGAGGTGG + Intronic
1142898693 17:2998951-2998973 TGATGGTGAGGGTGGAGAGGAGG + Intronic
1144176708 17:12714693-12714715 TGCTATGAAGGGTGATGAGGAGG + Intronic
1145302470 17:21650325-21650347 TGATAGTTATGCTGAGGAGGAGG + Intergenic
1149540409 17:57464086-57464108 TGATATTTTGGGAGATGAGGTGG + Intronic
1149796791 17:59528369-59528391 AGATATTTAGGCTGAAGTTGTGG - Intergenic
1149806928 17:59627009-59627031 AGCTATTTAGGGAGCAGAGGTGG - Intronic
1151937473 17:77271546-77271568 TGAAATTTATGGTGAAGGCGTGG - Intergenic
1152138077 17:78517628-78517650 TGATATTCAGGGAGAAGAGGAGG - Intronic
1157697911 18:49738368-49738390 TTGTATTTTTGGTGAAGAGGGGG + Intergenic
1164957752 19:32401819-32401841 TGATTTTTAAGAGGAAGAGGAGG + Intergenic
1165647810 19:37458041-37458063 TGATATTTTTGGTAAAGATGGGG + Intronic
1166171417 19:41029956-41029978 TGATTTTGTGGGGGAAGAGGTGG + Intergenic
1167580036 19:50335895-50335917 TGAGCTTTATGGTGAAGAGAAGG + Intronic
925075312 2:1012119-1012141 TGATTGTCAGGGAGAAGAGGAGG - Intronic
925828169 2:7870950-7870972 AGATAGTTTAGGTGAAGAGGGGG - Intergenic
925919528 2:8629384-8629406 TGGTATTTAGTGTGAAAAAGAGG - Intergenic
926397945 2:12465029-12465051 TTAGATTTAGTATGAAGAGGTGG - Intergenic
926545299 2:14232982-14233004 TGATATTGAGGCTGTAGTGGAGG + Intergenic
926572162 2:14541676-14541698 TGATATTTGGTGGAAAGAGGTGG - Intergenic
927948505 2:27151919-27151941 TGACATTTAGGGGAAAGAGGTGG - Intronic
928192359 2:29184135-29184157 TTATATTTAGGGTGATTTGGGGG + Intronic
928236411 2:29545416-29545438 TGACATTTAGAATAAAGAGGAGG + Intronic
928424715 2:31168520-31168542 TGATACTAAGGGTGAAGGAGTGG + Intergenic
928913617 2:36448028-36448050 TGATATTAAAGCTGAAGCGGTGG - Intronic
930217217 2:48709116-48709138 TGATGTATAGGGTTAAAAGGGGG + Intronic
930981761 2:57534367-57534389 GGATAGTTTGGGGGAAGAGGTGG - Intergenic
932640215 2:73438161-73438183 TCATCAATAGGGTGAAGAGGAGG + Intronic
932656235 2:73613345-73613367 TGATATTGAGGCTGTTGAGGCGG - Intergenic
935359252 2:102233572-102233594 TTATATTTAGGGAGGGGAGGGGG - Intronic
937636576 2:124162880-124162902 TGATGTTTAGGGATATGAGGAGG - Intronic
938364544 2:130724486-130724508 TGATGATAATGGTGAAGAGGAGG + Intergenic
939966955 2:148619649-148619671 TGATTTTTAGGGGAAAAAGGAGG - Intergenic
942948674 2:181698115-181698137 TGAGCTATAGGGGGAAGAGGTGG - Intergenic
943410961 2:187547196-187547218 TTATATTTAGGGGAAAAAGGGGG + Intronic
946590308 2:221239877-221239899 TGATTTTTAGGGAACAGAGGTGG - Intergenic
947488006 2:230570203-230570225 TGATGTCTAGGGAGAAGAGAAGG - Intergenic
948212350 2:236204058-236204080 ATATATTTAGGGGGAAGAGTGGG + Intronic
948300782 2:236905372-236905394 TTATATTTTTGGTGAAGATGGGG - Intergenic
948567051 2:238893996-238894018 AGATATTTAGGGGCAAGCGGAGG - Intronic
948926253 2:241100390-241100412 AGGTCTTTAGGCTGAAGAGGAGG - Intronic
1169529520 20:6469488-6469510 GGATATCTAAGGAGAAGAGGAGG - Intergenic
1169767211 20:9159971-9159993 CCATAGTTAGGGAGAAGAGGTGG + Intronic
1170000838 20:11611693-11611715 TGAGATTTATGGAGAAGTGGTGG + Intergenic
1170783822 20:19450408-19450430 TGATATTTACTGTGGGGAGGAGG + Intronic
1171126587 20:22607433-22607455 AGTTATTTAGGGTGGAGAAGCGG - Intergenic
1171535782 20:25887611-25887633 TGATATTTAGGGTGTATATTTGG - Intergenic
1171572078 20:26262291-26262313 TGATATTTAGGGTGTATATTTGG + Intergenic
1171805313 20:29673577-29673599 TGATATTTAGGGTGTATATTTGG + Intergenic
1171838741 20:30182853-30182875 TGATATTTAGGGTGTATATTTGG - Intergenic
1172232546 20:33346832-33346854 TAATGTTTAGGGTGAGGTGGAGG - Intergenic
1173399434 20:42711250-42711272 TGATATTTGGGGTCCAGGGGTGG + Intronic
1174638691 20:52024106-52024128 TGAGAACAAGGGTGAAGAGGTGG - Intergenic
1174993916 20:55544249-55544271 CTACATTTAGGGCGAAGAGGAGG + Intergenic
1175161396 20:57010317-57010339 TGAGACTTCGGGTGAAGAGGTGG - Intergenic
1176275762 20:64267525-64267547 CAATATTGAGGGTGAAAAGGGGG - Intronic
1177930296 21:27273226-27273248 TGATATTGGGGGTGAAGTGGGGG - Intergenic
1178629768 21:34249110-34249132 TTATAATTAGTGTGCAGAGGTGG + Intergenic
1181812853 22:25414708-25414730 TTGTATTCAGGGTAAAGAGGAGG - Intergenic
1182620791 22:31617417-31617439 TGATATTAAAGGTGCAGAGAAGG + Intronic
1182700766 22:32236012-32236034 CCATCTTTAGGATGAAGAGGGGG - Intronic
1182753323 22:32658676-32658698 TGGGATTTAGGGTGAACATGGGG + Intronic
1183249367 22:36718669-36718691 TGAGACTGAGAGTGAAGAGGTGG + Intergenic
949502052 3:4689664-4689686 TTATATTTGGGGTGAGGTGGTGG - Intronic
950171210 3:10840185-10840207 TGAGAAGTAGGGTGAGGAGGCGG - Intronic
952858355 3:37792016-37792038 TGAGATGTAGGATGAAGAGGAGG + Intronic
954621280 3:51997146-51997168 TGAACTATAGGGGGAAGAGGTGG - Intergenic
957503452 3:81088713-81088735 TGTTATTTCTGGGGAAGAGGGGG - Intergenic
957510241 3:81178817-81178839 TAATATTAAGGGAGAAGAGTAGG + Intergenic
958066879 3:88555079-88555101 ATATAATTAGGCTGAAGAGGTGG + Intergenic
958528193 3:95290376-95290398 AAATATTTTGGTTGAAGAGGTGG + Intergenic
960744560 3:120872835-120872857 CAATATTTAGGGGGAAGAGCAGG + Intergenic
960999956 3:123367549-123367571 TGATATTCCGGGAGAGGAGGAGG - Intronic
961095312 3:124149919-124149941 TGCTATTCAGGGAAAAGAGGAGG - Intronic
961709408 3:128815966-128815988 TGATGATTAGGGTCAGGAGGTGG - Intergenic
962989581 3:140566082-140566104 TGAGACTGAGGGAGAAGAGGAGG + Exonic
963032632 3:140993826-140993848 TGATGTTTAGTATGAGGAGGAGG - Intergenic
963063035 3:141240652-141240674 TGATTTTTGGGGGGAGGAGGGGG - Intronic
963393554 3:144702072-144702094 TGATAAGTAGGATGAAGAGCAGG + Intergenic
963643499 3:147884772-147884794 TGATAATCAGGGAAAAGAGGAGG + Intergenic
963663637 3:148155814-148155836 TGATATTTAGGGAAGGGAGGGGG - Intergenic
965264906 3:166531063-166531085 GGAGAATTAGAGTGAAGAGGGGG + Intergenic
968685264 4:1953702-1953724 TGATATTTAGGATGGAAAGAAGG - Intronic
969299255 4:6287874-6287896 TCCTCTTTAGGGAGAAGAGGGGG - Intronic
971379582 4:26084697-26084719 GGACACTTAGGGAGAAGAGGGGG - Intergenic
971740041 4:30507693-30507715 TTATATTTAGGGCTAAGTGGTGG - Intergenic
973304280 4:48627295-48627317 TAATATTTACAGTGAAAAGGGGG - Intronic
975129338 4:70816934-70816956 TGATCTTTAGGGTGTTTAGGTGG + Exonic
975686941 4:76925646-76925668 TGATGTTTAGGGTAATGAGTAGG + Intergenic
976149141 4:82075789-82075811 TGAGGTTGAGGGTGAAGACGAGG - Intergenic
979095606 4:116546345-116546367 TGATATTTTGGGAAAAGGGGTGG - Intergenic
979655389 4:123186860-123186882 AGATATGTGGGGTGGAGAGGGGG + Intronic
983125130 4:163942008-163942030 TGAAATTGAGTGTGAAGAGGTGG + Intronic
983491075 4:168389999-168390021 TGACATTTGGGATGATGAGGTGG + Intronic
984485444 4:180362382-180362404 TGATGTTTAGGAGGAAGAAGAGG + Intergenic
985013072 4:185604378-185604400 GAATATTTAGGGAGGAGAGGAGG + Intronic
987053746 5:14171067-14171089 AGATATTTTGGGTGAACAGTTGG + Intronic
987340893 5:16937632-16937654 TGATATTAATGGTGAAGAACTGG - Intergenic
988824584 5:34922461-34922483 TATTATTTATGGTGAATAGGTGG + Intronic
992717315 5:79523543-79523565 TGAGATTTAGAGAGGAGAGGAGG + Intergenic
994261887 5:97669276-97669298 TGATAGTTATTGAGAAGAGGAGG + Intergenic
995214042 5:109574242-109574264 GGATATTTAGAGTGGAGAGAGGG + Intergenic
998593207 5:143499826-143499848 TCACATTTAGCCTGAAGAGGTGG + Intergenic
998674898 5:144396216-144396238 TTACATTTAAGGAGAAGAGGCGG + Intronic
1000127585 5:158261711-158261733 TAATATTGTGGGTGAGGAGGAGG + Intergenic
1000209542 5:159097224-159097246 GGATGTTTTGGGGGAAGAGGAGG - Intronic
1003801766 6:9678213-9678235 TGATATGGAGGGTGAAGGAGAGG + Intronic
1007145200 6:39622595-39622617 TAATAGTTAGGGAGAAGGGGAGG - Intronic
1007350636 6:41271152-41271174 TGATATTTAGGGTGAAGAGGAGG - Intronic
1007678655 6:43618974-43618996 CTATATTTAGTTTGAAGAGGTGG + Intronic
1010333715 6:74655829-74655851 TGATATTTATGGGGTAGTGGGGG - Intergenic
1011465801 6:87655638-87655660 TAATAATTAGGCTGATGAGGGGG - Intronic
1011711707 6:90061524-90061546 TGATATTTAGGGGAGAGAGCTGG + Intronic
1012551302 6:100466698-100466720 TGACACTTAGGGTTAAGAGGAGG + Intergenic
1013015702 6:106159125-106159147 TTATATTTAAGGTGATGTGGTGG - Intergenic
1014654530 6:124084044-124084066 TTATATCTAGGGTGAAGGGGAGG + Intronic
1015696448 6:135985447-135985469 TGAAAATGAGTGTGAAGAGGAGG + Intronic
1017025292 6:150176124-150176146 TTATAATTGGGGTGAACAGGAGG + Intronic
1017295844 6:152792996-152793018 TGATATTTAGAGAAAAGAAGAGG + Intergenic
1018911384 6:168102263-168102285 GGATATTTAGGGGGAAGTCGGGG + Intergenic
1019839141 7:3421801-3421823 TGTTATTTAAGGTTAAGAGCAGG - Intronic
1022527839 7:31049821-31049843 TGATTTTTTGGGTGAATGGGTGG + Intergenic
1024885885 7:54141631-54141653 AGATCTTTAGGGAGAGGAGGAGG - Intergenic
1025287245 7:57674308-57674330 TGATATTTAGGGTGTATATTTGG - Intergenic
1025965863 7:66270427-66270449 GGATAGTTTGGGAGAAGAGGAGG - Intronic
1026224509 7:68428673-68428695 TGCTCTTTTTGGTGAAGAGGTGG + Intergenic
1026325370 7:69304961-69304983 TGATTTCTAAGGTGAAAAGGGGG - Intergenic
1027728815 7:81843378-81843400 TGATATTTAGGCAGAAGAAAAGG - Intergenic
1027962503 7:84964614-84964636 AGATATTTTGGGAGAAGAGGAGG + Intergenic
1028878149 7:95847155-95847177 TGATATGGAGGGTGAAGAAAAGG - Intronic
1029266301 7:99343811-99343833 TAATCTTTAGTGTAAAGAGGGGG - Intronic
1030056730 7:105589765-105589787 TAATATTAAGAGTGATGAGGAGG - Intronic
1030735382 7:113041956-113041978 TGAGATTTAGGAGGAAGAGGTGG + Intergenic
1031517066 7:122714068-122714090 TGAGATTTAGGGAAAAGAGGAGG + Intronic
1033389454 7:140912656-140912678 TGATTTTAAGAGAGAAGAGGAGG - Intronic
1033958530 7:146882507-146882529 AGAAATGCAGGGTGAAGAGGGGG - Intronic
1034165330 7:149021106-149021128 TGCCATTGAGGATGAAGAGGAGG - Exonic
1036818169 8:11917140-11917162 TAATATCCAGGGTGGAGAGGGGG + Intergenic
1037228883 8:16629957-16629979 TGATCTTTAGAGGGAAGAGGAGG - Intergenic
1037414244 8:18631867-18631889 TTATCTTTGGGGTGAAGAGATGG - Intronic
1039652407 8:39356378-39356400 TAATCTTTAGTGTGAAGAAGTGG + Intergenic
1040298380 8:46175106-46175128 AGATATTTAGGATGAAGTTGAGG + Intergenic
1040613529 8:49010795-49010817 TGATTTCTAAGGTGAAAAGGGGG - Intergenic
1042051579 8:64715291-64715313 TAATCTTTTGGGCGAAGAGGTGG + Intronic
1044165838 8:88982891-88982913 TGCTACTTAGGATGAAGAGCTGG + Intergenic
1044885689 8:96774526-96774548 TGATGGTAAGAGTGAAGAGGAGG + Intronic
1045921473 8:107535034-107535056 TGAGATTAAGAGTGGAGAGGAGG - Intergenic
1047105992 8:121730844-121730866 TGAGATTGAGGGTGAAGAGAGGG + Intergenic
1048060113 8:130910133-130910155 TGACATTGAAAGTGAAGAGGTGG - Intronic
1048803587 8:138218028-138218050 TTATACTTAGTGTGAAGAGGTGG - Intronic
1050021332 9:1287380-1287402 TGACATTTAGGTAGAAGAGGTGG - Intergenic
1050212921 9:3284294-3284316 TGTTACTTAGTTTGAAGAGGTGG + Intronic
1050760171 9:9059028-9059050 TTATACTTAGGGAGAAGAGAAGG + Intronic
1050938448 9:11427404-11427426 TGATATATAGGGTGATGCAGAGG - Intergenic
1050972951 9:11900178-11900200 TGTTAAGTAGGCTGAAGAGGTGG + Intergenic
1051543204 9:18244546-18244568 ATATATTTTGGGTAAAGAGGAGG - Intergenic
1052481831 9:29039432-29039454 TGATATTTAATGTAAAAAGGAGG + Intergenic
1053011038 9:34633512-34633534 TGGTATTGGGGGTGAAGAGTCGG + Intergenic
1055703337 9:78970654-78970676 AGATAGTTTGGGGGAAGAGGAGG - Intergenic
1056272130 9:84956451-84956473 TGATATTTAGAGTGAAGATTCGG + Intronic
1056630216 9:88287348-88287370 AGATATTTAGGGTAAACAGGTGG + Intergenic
1057096863 9:92318631-92318653 TGATTTTTAAGGTGAAGAACAGG + Exonic
1062189472 9:135240458-135240480 TTATATTTAGGTTGAGTAGGTGG - Intergenic
1186392080 X:9170875-9170897 TGGTTTTTAGGGGGAAGGGGTGG + Intergenic
1187489058 X:19733069-19733091 TGATGTTTGGGGAGGAGAGGTGG + Intronic
1187555569 X:20348040-20348062 AGTTATTTAATGTGAAGAGGGGG - Intergenic
1188546978 X:31318572-31318594 TGAGATTGAGAGTGAAGAGAAGG + Intronic
1188729030 X:33623129-33623151 TGTTCTTTAGGGTAAAAAGGAGG + Intergenic
1189326026 X:40111409-40111431 TGATTTTTAGAGTGAACATGAGG - Intronic
1190777159 X:53562140-53562162 TGATAGTCAGGATGAAGAGGAGG - Exonic
1193642951 X:84034306-84034328 TGATATATAGACTGAATAGGAGG - Intergenic
1196054255 X:111338249-111338271 TGGAATTCAGGGTGAAGAGGAGG + Intronic
1196743716 X:119048758-119048780 TGATAGTGATGGTGGAGAGGAGG + Intergenic
1199329763 X:146545060-146545082 TGAGATGCAGGTTGAAGAGGTGG + Intergenic
1199331274 X:146562637-146562659 TGACATTTAGGTATAAGAGGAGG + Intergenic
1201737507 Y:17284772-17284794 TAATAATCAGGGTGAAGAGATGG - Intergenic