ID: 1007350637

View in Genome Browser
Species Human (GRCh38)
Location 6:41271155-41271177
Sequence CCGTGATATTTAGGGTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007350637_1007350641 -7 Left 1007350637 6:41271155-41271177 CCTCTTCACCCTAAATATCACGG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007350637 Original CRISPR CCGTGATATTTAGGGTGAAG AGG (reversed) Intronic
900856809 1:5192167-5192189 CCCTGATATTTTGGGGGATGTGG - Intergenic
901420000 1:9144471-9144493 CCCAGATACTCAGGGTGAAGCGG + Intergenic
912198732 1:107430967-107430989 GGGAGATATTTAGGGTGGAGAGG + Intronic
1063149399 10:3322744-3322766 CCGTGAAGTTCAGGGTCAAGTGG - Intergenic
1063288648 10:4717299-4717321 CCCTTAAATTTAGGGTGAACAGG - Intergenic
1064043719 10:11991703-11991725 ACATGATATTTAGGGTTAAAAGG + Intronic
1065181269 10:23128694-23128716 CCGTGATAAGAAGGATGAAGTGG + Intergenic
1065926397 10:30437081-30437103 CCGTGAAATCTAGAGTGAGGGGG - Intronic
1090958722 11:131537018-131537040 CGGTGATGTTTAGGATGATGAGG - Intronic
1091093710 11:132796822-132796844 CCGTGATAGTGAGTGTGAAATGG + Intronic
1095330832 12:40960987-40961009 CTGTAATATTCAGAGTGAAGAGG + Intronic
1096005619 12:48168748-48168770 CAGTGATTTTTGGGGTGGAGGGG + Intronic
1101424309 12:104575504-104575526 CTGTGATAATCCGGGTGAAGGGG + Intronic
1102797391 12:115700637-115700659 CCGGGCTATTTGGGGTGAAAAGG + Intergenic
1116519087 14:45829332-45829354 CCCTAATATTTAGGGAGAAGGGG + Intergenic
1128138171 15:65279444-65279466 TGGTGATATGGAGGGTGAAGGGG - Intronic
1141053715 16:80796719-80796741 ATGTGATATCCAGGGTGAAGTGG - Intronic
1151086899 17:71390418-71390440 CAGTGAAAGTTGGGGTGAAGGGG + Intergenic
1152138078 17:78517631-78517653 GGGTGATATTCAGGGAGAAGAGG - Intronic
1156187211 18:34677125-34677147 CTGTGATATATGGGGTGAAGTGG + Intronic
1165427950 19:35756047-35756069 CCCTGTTGTTCAGGGTGAAGAGG - Intronic
926857677 2:17274474-17274496 CCCTGATATTTTGGTTCAAGTGG + Intergenic
930234079 2:48872491-48872513 CAGTGCTATTTGGGGAGAAGTGG - Intergenic
938750198 2:134320913-134320935 CCATGATTTTTTGGGGGAAGGGG + Intronic
939991809 2:148882779-148882801 CAGTGATGCTTAGGGGGAAGGGG - Intronic
942196500 2:173525869-173525891 CTGAGATATTTATGATGAAGAGG - Intergenic
946983849 2:225249256-225249278 CCATGAGATTTGGGGTGAAGAGG + Intergenic
1169707750 20:8525135-8525157 CAGTGACATTTATGGAGAAGGGG + Intronic
1177763469 21:25429865-25429887 CAGTGATCATTAGGATGAAGAGG - Intergenic
1178238213 21:30868590-30868612 CAGTGATATTGGAGGTGAAGGGG - Intergenic
1178552836 21:33556011-33556033 CCCTGATTTTTAGTGTGCAGAGG + Intronic
1179567879 21:42260498-42260520 CCATGTTATTTAGGGAGGAGAGG + Intronic
1184201997 22:42976207-42976229 CTGTGACATTTAGAGTGAGGAGG - Intronic
957668484 3:83268626-83268648 CAGTGATATTTATCATGAAGTGG - Intergenic
966061331 3:175760107-175760129 ACGTGATATTTAGGAAGAATTGG + Intronic
967248063 3:187508776-187508798 CAGTGAATCTTAGGGTGAAGGGG - Intergenic
967302420 3:188028221-188028243 GTGTGATGTTTAGGTTGAAGTGG - Intergenic
967514898 3:190356054-190356076 TCTTGAAATTCAGGGTGAAGAGG + Intronic
971351057 4:25856336-25856358 GCAAGATATTTGGGGTGAAGAGG + Intronic
973580902 4:52343193-52343215 CAGTGAAATCCAGGGTGAAGTGG - Intergenic
975028833 4:69587227-69587249 CCATGTTAGTGAGGGTGAAGTGG + Intergenic
977319821 4:95499454-95499476 CAGTGATATTCTGGGAGAAGTGG + Intronic
982900368 4:160991466-160991488 CCTTCAAATTGAGGGTGAAGGGG - Intergenic
993949821 5:94160748-94160770 CTGTGTTATTGAGGGAGAAGGGG - Intronic
998083283 5:139294079-139294101 GCGGGAGATTTTGGGTGAAGAGG + Intronic
1000595476 5:163210487-163210509 CCATGACATTTAGAGCGAAGAGG + Intergenic
1000896608 5:166862509-166862531 CAGAGTTATTTAGGGTAAAGGGG + Intergenic
1001718090 5:173833702-173833724 GAGTGATGTTTAGGGAGAAGGGG + Intergenic
1001840105 5:174868715-174868737 CAGCGAGATTTAGTGTGAAGAGG + Intergenic
1003353816 6:5346062-5346084 CCCTGATAGTCAGGGTGAGGTGG - Intronic
1006524635 6:34593286-34593308 CAGTTAAATTTAGGGTAAAGGGG - Intronic
1007350637 6:41271155-41271177 CCGTGATATTTAGGGTGAAGAGG - Intronic
1010985293 6:82416364-82416386 CAGTGCTATTTAGGAAGAAGAGG + Intergenic
1013219575 6:108066215-108066237 CCGTGATATGTAGGGTGAGGAGG + Intronic
1014654529 6:124084041-124084063 TAGTTATATCTAGGGTGAAGGGG + Intronic
1017848530 6:158281633-158281655 TCATGATTTTTAGGGAGAAGGGG + Intronic
1022621156 7:31985972-31985994 CCCTCACAGTTAGGGTGAAGTGG + Intronic
1023471254 7:40523115-40523137 CTGAGATATTTAGGGAAAAGTGG + Intronic
1041773359 8:61496785-61496807 CAGTGATTTTTATGGTGAGGTGG + Intronic
1044934062 8:97277097-97277119 CCGGGATATTTTGGATGAGGTGG + Exonic
1048451978 8:134541448-134541470 CTGTGAAGTTCAGGGTGAAGGGG - Intronic
1048613842 8:136052972-136052994 CAGTGAAATTTACGGTGAAATGG + Intergenic
1050490950 9:6187321-6187343 CAGTGATATTTATTATGAAGTGG + Intergenic
1050618962 9:7433219-7433241 CCCTGGTATGTTGGGTGAAGGGG + Intergenic
1056630215 9:88287345-88287367 CAGAGATATTTAGGGTAAACAGG + Intergenic
1056887179 9:90454688-90454710 CCAAAGTATTTAGGGTGAAGAGG - Intergenic
1059298664 9:113295545-113295567 CCTTGATATTCAGGGGGAAATGG - Intergenic
1193186672 X:78521526-78521548 CCATAATATTTACGGTGAAGTGG - Intergenic
1199329633 X:146543683-146543705 CAGTGAAATCTAGGCTGAAGAGG - Intergenic
1200325824 X:155237723-155237745 CTGAGATATTTAGGGTAAAAGGG - Intronic