ID: 1007350641

View in Genome Browser
Species Human (GRCh38)
Location 6:41271171-41271193
Sequence ATCACGGATCACCCTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1007350636_1007350641 -4 Left 1007350636 6:41271152-41271174 CCTCCTCTTCACCCTAAATATCA 0: 1
1: 0
2: 1
3: 25
4: 240
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1007350637_1007350641 -7 Left 1007350637 6:41271155-41271177 CCTCTTCACCCTAAATATCACGG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39
1007350635_1007350641 27 Left 1007350635 6:41271121-41271143 CCTGAACAGTTGTAGCTGGCACT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1007350641 Original CRISPR ATCACGGATCACCCTACACC TGG Intronic
907636313 1:56137944-56137966 ATCAGGGATGACCATACACGAGG - Intergenic
1084839541 11:71833835-71833857 ACCAGGGATGACCCCACACCAGG + Intronic
1093870396 12:24284299-24284321 TCCAGGGATCAGCCTACACCAGG - Intergenic
1096089515 12:48889626-48889648 ATCACTGATCCACCTGCACCTGG + Intergenic
1114247745 14:20930430-20930452 AACACCCATCACCCTACAGCTGG + Intergenic
1124010240 15:25832294-25832316 ATAACAGATTACCATACACCAGG - Intronic
1141663635 16:85454546-85454568 ATAATGAATCACCCTAAACCAGG + Intergenic
1146475897 17:33162556-33162578 ATCAGGGCTCAGCCTACAGCTGG - Intronic
1147733447 17:42618607-42618629 ATCACCCATCACCCCAAACCAGG + Intergenic
1156603384 18:38637475-38637497 ATCTCAGGTCACCCTACACTGGG + Intergenic
1156794446 18:41025761-41025783 ATCACAGATCACAATACAACAGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160246317 18:77162965-77162987 CTCAAGGAGCACCCTACTCCAGG - Intergenic
1162373127 19:10290611-10290633 ATCAGGAAGGACCCTACACCCGG - Intronic
928511550 2:32009246-32009268 GTCACTGGTCGCCCTACACCAGG - Intronic
1171327752 20:24310600-24310622 TCCACGGAACACCCTACCCCAGG - Intergenic
1175456119 20:59115816-59115838 ATCACAGCCCACCCTACTCCAGG - Intergenic
961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG + Intergenic
965572652 3:170187177-170187199 ATCATTGACCACCCTACACTGGG + Intergenic
973968456 4:56187204-56187226 ATCACTAATCACACTTCACCCGG - Intronic
975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG + Intergenic
979889825 4:126077325-126077347 ATCACAGATAACCCTCCATCAGG - Intergenic
982062104 4:151614953-151614975 CTCACAGAGCACCCTACTCCTGG - Intronic
989999638 5:50877876-50877898 ATCACAGAGCACCCTGGACCAGG - Intergenic
990197017 5:53329259-53329281 TTCAGGGATCACCCAACAACTGG + Intergenic
990210128 5:53473924-53473946 AACAAGTATCAGCCTACACCAGG + Intergenic
993878812 5:93339858-93339880 ATCATGAATCATCATACACCAGG - Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1016031435 6:139342841-139342863 ATCAAGGATTACCATACATCAGG - Intergenic
1018937628 6:168284016-168284038 ATCATGGAGCACCCTGCACCCGG - Intergenic
1023108033 7:36782327-36782349 AGCACGGACCACCCCACTCCTGG + Intergenic
1030778087 7:113561736-113561758 ATTACGGACCTCCCTACTCCAGG + Intergenic
1031055584 7:116989858-116989880 ATCAAGGATCACCAGACACAAGG - Intronic
1044930462 8:97247119-97247141 ATCAGGGCTCACCCTGGACCTGG + Intergenic
1046431601 8:114135183-114135205 ATCAGGGGCCACCCTACTCCAGG - Intergenic
1057817319 9:98305116-98305138 AACACAGATCACCCTACTGCAGG + Intronic
1060823510 9:126674510-126674532 GTCAGGGATCTCCCCACACCAGG - Intronic
1061490516 9:130941417-130941439 ATCACGGCTGACCCTTCTCCTGG - Intergenic
1185668197 X:1785051-1785073 ATCATGCTTAACCCTACACCTGG - Intergenic
1201758972 Y:17517916-17517938 ACCACTGATGACCATACACCTGG - Intergenic
1201842583 Y:18388074-18388096 ACCACTGATGACCATACACCTGG + Intergenic